Transcript asmbl_18054

Sequence
Transcript Sequence for observation asmbl_18054 of TGE0032192:
CCTCTCGCGAGAGGGAGGTGCGGTGTGTCTCTCTTCCCGAGTGGTCCCCGCTGGTTACTGGAGGAGCGCTCGTTCTAGTTCGTCCACCATGGCGTCCGTGGGGACCCTCGCCTTCGATGAGTATGGGCGCCCCTTTCTCATTATCAAGGACCAAGATCGCAAGTCCCGTCTCATGGGGCTTGAGGCCCTCAAGTCTCACATCATGGCTGCCAAAGCTGTAGCAAACACAATGCGGACGTCACTGGGACCAAACGGGCTGGACAAGATGATGGTTGATAAGGATGGCGATGTGACTATAACAAACGATGGTGCCACCATTCTAAGCATGATGGATGTCGATCATCAGATTGCCAAGCTGATGGTTGAACTGTCCAAATCCCAGGATGATGAAATTGGAGATGGGACCACAGGAGTGGTTGTCTTGGCTGGGGCCTTGTTGGAAGAAGCTGAACAGCTGCTGGACCGAGGCATCCACCCAATCAGAATTGCTGATGGCTACGAGCAGGCTGCCCGAATTGCAATACAACACCTGGACAAGATCAGCGATAAAGTGCTTGTCGACATAAACAACCCTGAACCTCTGATTCAGACTGCAAAAACCACGCTGGGCTCCAAAGTGATTAACAGCTGTCACCGACAGATGGCTGAGATCGCCGTGAATGCCGTCCTCACGGTGGCAGATATGGAGCGGAGAGATGTTGACTTTGAGCTCATTAAAGTGGAAGGCAAAGTAGGTGGGCGGCTGGAAGACACCAAGCTCATAAAGGGTGTGATCGTTGACAAGGACTTCAGCCACCCACAGATGCCGAAAAAAGTGGTAGATGCTAAGATTGCGATTCTCACGTGTCCATTTGAGCCACCTAAACCTAAGACAAAGCACAAGCTGGATGTCATGTCTGTGGAGGACTACAAAGCCCTGCAGAAGTACGAAAAGGAGAAGTTTGAAGAGATGATTAAGCAGATTAAAGAAACTGGTGCTAACCTAGCTATTTGCCAGTGGGGCTTTGACGATGAAGCCAATCACTTACTTCTTCAGAACGGCCTACCTGCAGTCCGCTGGGTAGGGGGACCTGAGATTGAGCTGATCGCCATTGCAACAGGAGGACGGATTGTCCCACGGTTCTCAGAGCTCACCTCTGAGAAGCTGGGCTTTGCTGGTGTGGTGCAGGAGATCTCCTTTGGCACTACAAAAGACAAAATGCTGGTTATCGAGAAGTGTAAGAACTCTAGAGCTGTGACCATTTTCATCAGAGGAGGAAACAAGATGATCATAGAAGAAGCAAAACGATCTCTCCATGATGCCCTGTGTGTCATCCGGAACCTCATCCGTGACAACCGTGTTGTGTATGGAGGAGGGGCAGCCGAAATATCCTGCGCCCTGGCAGTCAGCCAAGAGGCAGACAAGTGCCCAACTTTGGAACAGTATGCCATGAGAGCTTTTGCAGATGCCTTGGAGGTCATCCCCATGGCCCTTTCAGAAAATAGTGGCATGAATCCCATTCAGACCATGACTGAAGTTCGAGCCAGACAGGTGAAGGAGTCTAACCCTGCCCTGGGGATTGACTGTTTGCACAAGGGCAGTAACGATATGCAGTATCAGCATGTCATAGAAACCTTGATTGGCAAAAAGCAGCAGATCTCTCTTGCCACCCAGATGGTTAGGATGATTCTGAAGATTGATGACATCCGTAAGCCTGGAGAATCTGAAGAATAAACTGTACCATTTACCACTGTGACTAAATAAAGGGTGTGTCTGTTGTGCTGCGTCTGCAGTTACTGCTGGTCCTCTCACAGCTGTAGATGCTGGAATAAAAGCAGCTGTCTGGT