Transcript asmbl_18041

Sequence
Transcript Sequence for observation asmbl_18041 of TGE0036197:
GGCGCGGGACGGCGGGAAGGTGACGGCCGGCGCGCAGCCCCGGGCCGCGACGCGATGCCCGGCCGAGCACGAGGAGGACATGTACCGTGCTGCAGATGAAATAGAAAAGGAGAAAGAATTGCTAATACATGAAAGAGGGATATCAGAACCCAGGTTAAGTGTGGCTCCTGAAATGGATATCATGGACTACTGCAAAAAAGAATGGAGAGGAAATACTCAGAAAGCCACATGTATGAAAAAGGGCTATGAGGAAGTGTCTCAGAAATTCACTTCCATAAGGCGAGTCCGTGGTGATAACTACTGTGCACTGAGGGCCACACTGTTCCAGGCCATGAGCCAGCTGGCCGAGCTGCCCCCCTGGCTGCAGGACTTGGAGCTCATACTGTTACCAGAGAAGCTGATAAACAAGTATACCTGGATCAAGCAGTGGAAACTTGGACTGAAATTTGATGGGAAGAGTGAGGACCTGGTTGAAAAAATTAAGGAATCCCTTGCCCTGCTAAGGAAGAAGTGGGTAAGCCTGGCTGCAATGAAAACTGCTGAAGCGAGGCAGACAGCTTGTGATGAGCTGTTCACCAACGAAGAGGAGGAGTACAGCCTCTACGAAGCTGTGAAGTTCCTGATGTTAAACAGAGCCATCGAACTGTACGATGACAAGGAGAAGGGAAAGGAAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCTCCTGAGGAACCACCTAAACCAGGTGGGACACACGGGGGGCCTTGAGCAGGTTGAGATGTTCCTTCTTGCCTATGCTGTCCGCCACAGCATCCGGGTGTACCGGCTGTCCAAGTATAACACAGAGGAGTTCATCACAGTCTACCCCACTGATCCCCCCAAGGACTGGCCAATGGTGACCCTCATAGCTGAGGATGATCGGCACTATAACATCCCTGTCAGAGTGTGTGAGGAGACCAGTGTGTGAGGGACACACATGTGACTGCCAAGAGATGCGCATGTGCAGCTCCTCCTCTGGGGGCCTCAGATCTGCAGGTCTCCAAGGACAATCTGGGAGAACTCTCGGGCCCCTGGAGCCAACTTTGGACCATTATGTTCTGAAGACTAGCTGTTGATAATGAGAATTAATTAGCCAAGCCTTCACTCCTTGTTCTGTTATGCAGTGTGTTCCACTGGGGGCTTCAGCACGTGCCTTTGGAAGGTGCAAACTATGTCTCCATAAGGCGGATGCTTTTGGGTCAAA