Transcript asmbl_18029

Sequence
Transcript Sequence for observation asmbl_18029 of TGE0032183:
CAGGAAGCGAGCCCGGCAGCCGCACTTTCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGGTATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAAGTTTCGGAAGAGCGATACAAACGAGTGGAACAAGAATGATGACCGTCTGCTGCAGGCTGTGGAGAACGGAGATGCTGAGAAGGTGGCCTCACTGCTGGGCAAGAAAGGGGCCAGCGCCACGAAGCATGACAGCGAGGGCAAGACCGCTTTCCACCTTGCCGCTGCGAAGGGACACGTGGAATGCCTCAAGGTCATGGTGACACACGGTGTGGATGTGACTGCCCAAGATTCTTCCGGTCACAGTGCTTTGCATGTCGCAGCCAAGAATGGCCACCCAGAGTGCATCAGGAAGCTTCTTCAGTACAAGAGCCCAGCGGAGAACATTGACAACTCGGGGAAAACAGCTTTGCATTATGCAGCGGCACAGGGATGCCTTCAGGCTGTACAGCTCCTCTGCGAACACAAGAGCCCCATAAACCTTAAAGACTTGGATGGGAACATCCCCCTGCTTGTTGCAGTCCAGAACGGCCACAGTGAGGCCTGCCACTTTCTCCTGGATCACGGCGCAGATGTCAATTCCAGAGACAAAAATGGAAGAACTGCTCTCATGCTGGCTTGTGAAACCGGCAGCTCGAACACTGTGGACGCCTTAATTAAAAAGGGAGCGGACCTGAGCCTTGTCGATTCTCTCGGACACAATGCCTTACATTATTCCAAACTCTCGGAAAATGCAGGAATTCAAAACCTTCTATTATCAAAAATCTCTCAGGATGCTGATTTAAAGACTCCAACAAAACCAAAGCAGGCTGAGATCAGCTCCATACAAGAAAACAAAGACAGGCTGAGCGACAGTACTGCAGGTGCTGACAGCTTGTTGGATATAAGTTCTGAAGCTGACCAACAAGATCTTCTTGTCCTGTTGCAAGCAAAAGTCGCTTCCCTTACCTTACACAATAAGGAGTTACAAGATAAATTGCAGGCCAAATCGCCCAAGGACAAGGAAGCGGAAGCCGACCTAAGCTTTCAGTCTTTCCATTCGACCCAGACTGACCTGGCCCCATCCCCGGGCAAAGCTAGTGACATCCCTTCCTCCGATGCCAAATCATCCCCACCCGTTGAGCATCCGGCGGGGACGTCCACCACTGACAATGATGTCATAATCCGGCAGCTCCAAGATTCCCTGCATGATCTGCAGAAGAGATTGGAGAGCTCCGAAGCAGAGAAGAAACAGCTCCAGGACGAACTCCAGTCACAAAGGACAGACACGCTTTGCTTGAACAACACAGAGATCTCCGAGAATGGCTCTGACCTCAGTCAGAAGCTCAAGGAAACCCAGAGCAAGTACGAAGAGGCCATGAAAGAAGTCCTGAGCGTGCAGAAACAGATGAAGCTGGGTCTCCTCTCCCAGGAGAGCGCCGATGGCTACTCGCATCTCCGGGAGGCGCCAGCTGACGAAGACATCGACACACTAAAGCAAGACCTGCAGAAAGCGGTGGAAGAAAGTGCAAGGAACAAGGAGCGGGTGCGGGAGTTAGAGACTAAGCTTGCGGAGAAGGAGCAGGCCGAAGCGACTAAGCCACCTGCCGAGGCGTGTGAGGAGCTGAGAAGTTCCTACTGCTCTGTTATCGAGAATATGAATAAGGAGAAGGCATTTTTGTTTGAGAAATATCAACAGGCCCAAGAAGAGATCATGAAACTGAAGGACACGCTAAAAAGTCAGATGCCACAGGAAGCCCCCGACGACTCTGGGGATATGAAAGAGGCCATGAACAGGATGATTGATGAACTCAATAAACAGGTGAGCGAGCTGTCACAGCTGTACCGAGAAGCCCAGGCAGAGCTGGAGGATTACAGGAAGAGGAAATCTCTGGAAGATGCAGCCGAGTACATTCACAAAGCTGAACACGAGAGGCTGATGCACGTGTCAAACCTGTCCAGGGCCAAGTCGGAAGAAGCGCTGTCGGAGATGAAGTCTCAGTATTCCAAAGTGTTGAACGAGTTGACTCAGCTCAAACAGCTGGTGGATGCACACAAAGAGAACTCCGTGTCCATCACAGAGCATTTGCAAGTGATAACCACGCTGCGGACAACGGCCAAAGAGATGGAAGAAAAGATAAGCGCCCTCACAGGGCACCTTGCAAACAAGGAAGCGGAAGTGGCAAAGCTGGAGAAGCAGCTCGCCGAAGAGAAGGCTGCCGTGAGCGACGCGATGGTCCCCAAGTCTTCCTACGAGAAGCTCCAGGCCTCCTTGGAGAGCGAAGTCAATGCCTTAGCAACAAAGTTAAAGGAGTCAGTAAGAGAGAGAGAGAAAGCCCATTCCGAGGTGGCCCAGGTTCGAAGTGAGGTCTCACAGGCGAGAAGGGAAAAGGACAACATCCAGACTCTCTTGAAAGCCAAAGAGCAGGAAGTAACTGCGCTTGTGCAGAAGTTCCAGCGAGCTCAGGAAGAACTGGCTGGGATGCGAAGATGCTCTGAGACCTCGTCGAAGCTGGAGGAGGATAAAGATGAAAAGATAAATGAAATGACCAGGGAAGTCCTGAAGCTGAAGGAGGCCCTGAACAGCCTCTCGCAGCTCTCCTACTCCACAAGTTCATCCAAGAGGCAGAGCCAGCAACTGGACCTGCTACAGCAGCAGGTCAAGCAGCTGCAGAACCAGCTGGCTGAATGTAAGAAACACCACCAGGAGGTCATCTCAGTTTACAGAATGCATCTTCTATATGCCGTTCAGGGCCAAATGGATGAAGATGTCCAGAAGGTCTTGAAGCAGATCCTCACCATGTGTAAAAACCAGTCTCAGAAGAAGTAAAAATGGATTCTTTGGCAGGACACTTGCCCCTCGTTGCCTCTCTTTGTGTTAGATCTGGGGTTGTCACTGACCACTGCCATTGTTCTTATCCATAGTGTGCACTGTGACCCATCGTAGCATCTTTTCCAGAGGTTTCTGAGGGCTAGTCCCAAGAGAAGATACCCTCTTCAGAACTGCATAGGTACTCCAGACCAGCAGAGGTGAAAGACCCTGCTATCTCTTCAGAATCTAGCACTGGGATTGGCACCATCCCGGTGGCTTTATGGAGTGATGTGCTGAAGCCACCATGCAGTGAGTGGTCCTTGATCCCTGCCTTTGGGATGTGCCATTCAGCACAGGAGAGCATTTTGCCTTCCATTCCCCAAATATGATTTAATTCCTAACCAAACTAAAATGACACTAGAAGTGAATGCTTAAGACCCTTTCTCCTGTGGATTTAAAAACTCTACTCTGTCCCCCCAGCTGCCTTAAATCTCATCCCCTTGCTTGTGGTCTCATCATTTGATGAGTATCATTAACTAAAGTACAACGTTTTAAGCCAAGAGTGAAGTCTCCTTAAAAGTTTTCAGTAAGTCAACATACTGTAAATTTTCTATGCAAACTTGCCTAGAAAACTTTCCACAATGCTCAGGAAGTCCAGATATTTGTATTTCAACAAAGGACAGTAAACTATGTGTTTACAGCCAAAAGACATGCCTCATAGTTCTTAACCTCAATTTTTTAAAAGTGTTTTTTTTCCTCTATGATATTTTTATTGGCTTTTAAAGATGTTTTCATAGCTAAAGCCCTAAGTAAGTGAGATTAGATTATATTAACATTATTTTTAGATAAACATACTTAAGACTTCTCAAAAATGTAACTTTTTCCTCAAAAGTTTTCAGAGGGTAGTTATATATTCCAAACTCAGTATGAGCTGCCACCAGAACCACTAGGAATTTCTGTAGTCTACTTCTGAATGCAGTAAATACTCCTTTTGCCCGTTGAACTTGTAAACACCTCAAACTCTAGCACCCACGAATGATTCCTGAAAGGGCTGTCAGTTCCAGTCAGCTTCTCCATGTTGAAAGTAAAAGTTCCAACATGGCACCGCGGTGCATAGCAGAAACCTCGGGGGAAATACGCCTACCGACCTTACTTTCAGGTTGAAAAGGTTCAACTTGCTTGCAGCTTCTCTTACAGCCCCCATGGTGAGGGAGATAAATGAAATAAAGGAACTTTGGGTGTGTTACTAAAGGTAGCGGTCTACTCTGACAGGACCCATCTGAGGCCACGTGGCTGAGTTGGGTCTGTTCATCTGTCTTAGGTAACGATCAATACCAGCATGAATTGGGTCTGTTCATCTGTCTTAGGTAATGATCAATACCAGCA