Transcript asmbl_16643

Sequence
Transcript Sequence for observation asmbl_16643 of TGE0032154:
GCGGCGGCCCCGGCCGAGGTGCGCGCTGGTGGGGAGGGGGGGCCTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGAGCCTGGCCCAACTAGAGAATCTGTGCAAACAGTTGTATGAAACAACAGATACAACCACTCGACTGCAGGCAGAGAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTGCTCCTCGAGAGAGGAAGTTCGTCCTACTCCCAGCTGCTGGCAGCTACATGCCTTACCAAGCTCGTGTCTCGGACAAACAACCCCTTGCCACTGGAGCAGCGGATAGATATCCGGAACTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCAACTTTCGTGACTCAAGCCCTCATCCAGCTGTATGCCAGGATCACAAAGCTGGGCTGGTTTGACTGCCAGAAGGATGACTATGTCTTCAGAAACGCAATCACAGACGTCACAAGGTTCCTGCAGGACAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTCACCAATGAAATTAATCAAGCAGACACAACTCATCCTTTAACCAAACACAGAAAAATAGCCTCTTCTTTCCGAGACTCATCACTGTTTGATATCTTCACACTTTCCTGCAATTTACTAAAACAGGCATCAGGAAAGAATCTGAACTTGAATGATGAAAGTCAGCATGGCTTGCTAATGCAACTGCTCAAACTCACCCACAACTGTCTGAACTTTGATTTTATCGGCACATCTACTGATGAGTCCTCAGACGACCTGTGTACAGTGCAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCGACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATTCCTCCCTCGTTCTCACCTTTGGTATTGTCCTGCTTAGTACAGATTGCCTCAGTCCGGAGATCCCTATTTAACAATGCTGAGAGGGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTCTGCAGACTACTGGCTCGGTTAAAGAGTAACTACCAACTGGGAGAACTGGTAAAAGTGGAAAACTACCCTGATGTTATCCGATTGATAGCCAACTTCACAGTGACCAGCCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTACCATATGTCAAAGCCACAGAGCCCCATATGCTGGAAACATATACTCCTGAGGTTACCAAAGCCTATATCACATCCCGCTTGGAATCTGTGCACATCATTCTGAGGGATGGCCTGGAAGATCCCCTGGAAGATACAGGTCTGGTCCAGCAACAGCTGGACCAGCTGTCCACCATCGGGCGTTGTGAGTATGAGAAGACATGCGCGCTCCTTGTGCAGCTATTTGACCAGTCGGCCCAGTCGTACCAAGAACTGCTGCAGAGTGCCAGTGCCAGCCCAATGGACATTGCAGTGCAGGAGGGACGACTGACGTGGTTAGTCTATATCATTGGAGCTGTGATTGGTGGCCGAGTTTCTTTTGCCAGCACTGATGAGCAAGATGCAATGGATGGTGAGCTTGTCTGTCGGGTGCTCCAGCTTATGAACCTGACAGATTCCCGCTTGGCTCAGGCTGGTAATGAGAAGCTTGAATTGGCCATGCTGAGTTTTTTTGAGCAGTTTCGTAAGATCTACATTGGGGATCAGGTGCAGAAATCCTCAAAGCTGTACCGCCGACTCTCAGAAGTTCTGGGATTGAATGACGAGACGATGGTGCTGAGTGTCTTCATAGGAAAAGTCATCACCAACTTGAAGTACTGGGGTCGTTGTGAGCCAATCACCTCCAAGACACTGCAGCTCCTCAATGACCTCTCCATCGGATACAGTAGCGTAAGGAAGTTAGTGAAGCTTAGCGCTGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACTACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCTCTAACAGCAGCGTTTGAGGCTGTGGCCCAGATGTTCAGCACTAACAGCTTCAATGAACAGGAGGCAAAGAGAACTCTGGTTGGCCTAGTGAGAGACCTGAGAGGGATAGCCTTTGCCTTCAATGCCAAGACCAGTTTCATGATGCTCTTCGAATGGATATACCCCTCCTACATGCCAATTCTCCAGCGGGCAATTGAGCTCTGGTACCATGACCCAGCCTGTACCACTCCTGTGCTCAAGCTGATGGCTGAATTAGTTCATAACAGATCTCAGCGACTCCAATTTGATGTTTCATCTCCCAATGGTATCTTACTTTTCCGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTGCCAAAGGATCAGGTCTATGCTTTGAAGCTCAAGGGTATCTCCATCTGCTTCTCCATGCTGAAGGCTGCCCTCAGTGGGAGTTATGTCAACTTTGGGGTCTTCCGTCTCTATGGAGATGATGCCTTGGAAAATGCCCTACAGACCTTCATCAAACTACTCCTCTCTATTCCTCATAGTGACCTCCTGGATTACCCCAAGCTCAGCCAGTCTTACTACTCACTACTGGAAGTCCTGACCCAGGACCATATGAACTTTATTGCAAGCCTGGAACCTCATGTCATCATGTACATCCTCTCTTCTATTTCTGAAGGACTTACTGCACTTGACACCATGGTATGCACGGGCTGCTGTTCCTGCCTAGACCATATTGTGACGTATCTCTTCAAACAGCTGTCACGGAGCACCAAGAAAAGGACAACACCCCTGAACCGGGAGAGTGACTGCTTTCTGCATATCATGCAGCAGCATCCAGCTATGATCCAGCAGATGCTGTCCACGGTGCTGAACATCATTATCTTTGAAGATTGTAGGAATCAGTGGTCTATGTCTCGACCCCTGCTTGGCTTAATACTGCTTAATGAAAAGTATTTTTCTGACCTAAGAAACAGCATCGTCAATAGCCAACCACCAGAGAAACAGCAGGCCATGCATCTGTGTTTTGAAAATTTGATGGAAGGCATTGAACGGAATCTTCTGACGAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAGGTCAACGACTCAATGAAGAATTCCACTTATGGAGTGAATAGCAATGACATGATGAGCTGACAACTCTCGGACTCTACCTTGCAGAGCAGCGTCCCTTTGGTCTGGTCCAGAGGGTGAACAGTTGCAAGGGAGAGAGCCTGGCTGATCCCGGCTCCTTCCTCCAGGGGTATGGGGGAAATGGCAAAAGTCAACCAGCTATTTCCCCAGAAAGTACGGGGAAGTACGGGGTGTGCGTGCACTCACTGAGGGACAGGGCACTGCTGGTTCCTG