Transcript asmbl_16551

Sequence
Transcript Sequence for observation asmbl_16551 of TGE0032146:
GGCCCCGCCTCCTCGCCCTGCCCACTCCCCGGCGTCTAAACACAGGTGGGAGCGGGAGATCCCGACAGGTGAGCCCCGCGCCCAGCAGTCGCAAGGATGGAGTTCGTCAAGTGTCTAGGCCACCCGGAGGAGTTCTATAACCTGCTGCGATTCCGCATGGGAGGCCGGCGGAATTTTATACCCAAGATGGACCAGGACTCACTCAGCAGCAGCTTGAAGACCTGCTACAAGTATCTCAATCAGACCAGTCGCAGCTTTGCCGCGGTTATCCAGGCGCTGGATGGGGACATACGGCACGCCATATGTGTGTTCTACCTGGTTCTCCGAGCCCTGGATACAGTGGAGGATGACATGAGCATCAGTGTGGAGAAGAAGATCCCACTGCTGTGTAACTTCCACACTTTCCTCTATGACCCAGAGTGGCGGTTCACTGAGAGCAAGGAGAAGGACCGACAAGTGCTGGAGGACTTCCCCACGATCTCCCTGGAGTTTAGAAATTTGGCTGAGAAATATCAAACAGTGATCGATGACATCTGCCACCGGATGGGGTGTGGGATGGCAGAATTTGTAGACAAGGATGTGACCTCCAAACAGGACTGGGACAAGTACTGCCACTACGTTGCTGGGCTGGTGGGAATTGGCCTTTCTCGTCTATTCTCTGCCTCAGAGTTTGAAGACCCCATAGTTGGTGAAGACATAGAGTGTGCCAACTCAATGGGTCTGTTCCTGCAGAAAACAAATATCATTCGTGATTATCTGGAAGACCAACAGGAAGGAAGGAAGTTTTGGCCTCAGGAGGTGTGGGGCAGATACATTAAGAAGTTGGAAGACTTTGCTAAGCCAGAGAACGTAGATGTGGCCGTGCAGTGCTTGAATGAACTCATAACCAACACCCTACAGCACATCCCTGACGTCCTCACCTACCTGTCAAGGCTCCGGAACCAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTAATGGCCATTGCCACACTGGCTGCCTGTTACAATAACCAGCAGGTATTCAAAGGAGTAGTGAAGATTCGGAAGGGGCAAGCAGTCACCCTCATGATGGATGCCACCAACATGCCTGCCGTCAAAGCTATCATATACCAGTACATAGAAGAGATTTATCACCGGATCCCCAACTCAGACCCATCATCAAGCAAAACCAAGCAGGTCATCTCCAAGATCAGGACACAGAACCTTCCCAACTGCCAGCTCATCTCCCGAAGCCACTACTCCCCCATTTACCTGTCATTTATCATGCTCTTGGCTGCCCTGAGCTGGCAGTACCTGAGCACCCTGTCCCAGGTCACAGAAGACTATGTCCAGAGAGAACACTGATTTTGTTTAGCCGGAAGTGGAAGTTCCCGTGGAGTGGGTTTTTCCTTTTCCTCCAGCTGGATTTTGACTTCCCTTGTTTTTCCTCCTACTCTAAAATCTTTGGGAGAACTGAGTGTGGGACCTTTAGGAACTGGGCAGAGGAAAGGATGCCTTGCCCTCAGCAGCCTGGTGCTGGCTGGGACTTGGTTCCTCTGCCTCTTGTAGCCACTGGCAGCGTGCCGACTGCTGCACTTGTGAGGCCACGTGTGATGGTCACAAGAGCCTAGTGAACCTGGCTAGAATGCTGATTGGATTTATTTAATTTGAAACAGCCTTTGAATACCTATGACAATAGAAAATGAAAGCAA