Transcript asmbl_25153

Sequence
Transcript Sequence for observation asmbl_25153 of TGE0000808:
TGAGTCTTGATCCTCGGCAGGCACCGTACCCAGTTTCCTCCGTTGGGAGGGTTTAACTGCCCGGAAACGGAAGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCGCCATGCCTCGGAAAATTGAGGAAATCAAGGACTTCCTGCTCACAGCCCGACGAAAGGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGACAACGTGAAGTTTAAAGTTCGATGCAGCAGATACCTTTACACCCTGGTCATCACTGACAAAGAGAAGGCAGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAACTGAAATGAACCAGACACACTGATTGGAACTGTATTATATTAAAATACTAAAAATCCT