Transcript asmbl_15056

Sequence
Transcript Sequence for observation asmbl_15056 of TGE0003333:
CGCGTTGATATGATTGGTCGGCAGTGAGCGGTCCTCTTTTCCTCCTCTCCAGCTCCGGCGCCGTAGCCATCATGAATGACACAGTAACCATCCGGACCAGGAAGTTCATGACCAACCGTCTGCTTCAGAGGAAACAGATGGTCATTGATGTCCTTCATCCTGGGAAGGCAACAGTACCAAAGACAGAAATTCGGGAAAAGCTGGCCAAAATGTACAAAACCACACCAGATGTCATCTTTGTATTTGGATTCAGAACCCACTTCGGTGGTGGCAAGACCACTGGCTTTGGCATGATCTATGATTCTTTAGATTATGCAAAGAAGAATGAGCCTAAACACAGACTGGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAACAGCGAAAGGAACGCAAGAACAGAATGAAGAAGGTCAGGGGCACGGCGAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGTGGAGATTGGATACAGCCAAAGGAGTAGATCTGCGGTGACTTGATGTTTTGCTGTGATGTGCAGATTTCTGAGAGGACAAATAAACTAAAAAGCTCCTACACGTCTGCTCTGCTGCTTATTGGGCATTAGAAGAATCAGGTGGCTGCTTGGGTGTTGATGCAGTCAAGTGCACTGGGCTTGGTGAAAAGCCCAGTGTAAGAGGCCGGTACAGATCCTTCCTGGCAGAGGGTGGTGATGGAGAGAAC