Transcript asmbl_15051

Sequence
Transcript Sequence for observation asmbl_15051 of TGE0032038:
CATTGCCTAACCCGAGGCCCCGCAGCTCCTGCTCGCCCCGTCCCCGCCGGACGGTCCGAGACCGCTCACCCAAGGAGACCGCCGTGCTCTCGACCCACGTGGTCACTCCGGAGCAGGTGGGAGTGGGCAGCGGGCGGAGCGGCAAGGACAGGCGCGGTAGACAGCCCGGGCGGCCGCGGCGGGGACCTGGCTGGGGGAGGCCAGGCTTGCGGCGGGGCGCAACGGTGTCTCCTTCACTTCGCCCTCCAGCCGCGGTGGCTGCAGCGCAACTTTCAGATAGCGGAGTGGCCTCAGCTGCGAGCCGAGCGGTGGCGGCAGCGCCCCTCAGGACACCCGCAGATCACCTTTTCCCCGCGACTTCGCCATGGCTGAGTGCTGTGTACCGGTATGCCCACGGCCGATGTGTATCCCTCCACCCTATGCTGACCTCGGCAAAGCTGCCAGAGACATTTTCAACAAAGGATTTGGCTTTGGGCTGGTGAAGCTGGATGTGAAGACGAAGTCATGCAGCGGTGTGGAATTTTCAACATCTGGCTCATCTAATACAGACACTGGTAAAGTTAGCGGGACCTTGGAGACCAAGTACAAATGGTGTGAGTATGGTCTGACTTTCACAGAGAAGTGGAACACCGATAACACTCTGGGGACAGAGATTGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACTTTTGACACCACCTTTTCACCGAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTGCTTACAAGAGGGAGTGTATAAACCTCGGCTGTGATGTTGACTTTGATTTTGCTGGACCTGCCATCCATGGGTCAGCTGTCTTTGGTTACGAGGGCTGGCTTGCTGGGTACCAAATGACCTTTGACAGTGCCAAGTCAAAGCTGACAAGGAGTAACTTTGCAGTCGGCTACAGGACTGGGGACTTCCAGCTACACACAAATGTAAATAATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTATGTGAAGATTTTGACACTTCAGTAAACCTCGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATACCAGTTGGATCCTACTGCTTCTATCTCTGCAAAGGTCAACAACTCTAGTTTAATTGGAGTGGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTGTCTGCTCTGGTAGACGGGAAGAGCTTTAATGCTGGAGGCCACAAACTTGGGCTTGCCTTGGAATTGGAGGCTTAATCCAGTTAAAAGAAACCTCTGGGAACGAATATCAGAAGATTTGGCCTTAATATATTTCCATGCGACCAGCAGGCTCCCCTTCCTTCCCCCAGAAGGTGATCACATCAAAGGATGATGAAGCAAGAGCTGTATTTTAAATATTTAGACAGTCACTGTTGGCTGGTTCCTAGTTGGATGGTTATCAGTGCTGCCGTGGTGCGGCCCCCTATACATTATTTAAATGTATTTAACTGTTAAATGTGCTACCCACCAATGATGAAATAGACGTTTATGAAAACCGTGCCATGGTGTGCATGTTTGTTTTATGTTCCTTTTAACATTGACTATTGTACTGAATGAGATGGATCAGTGGCTGTTTTAAGATGAGGTAAAAGATTTTTTTTTGTTATATTCACCCATCATTAGAATTACTTTGGTAACCCCAAACATGACAAATTATGAATAAAACAAGTGTACATAACTAATGGCTCACGTATGTGCAGTTACAGATTGCCAGCCTAGGGTCTAATCTTCTTGGCAAATACTTTTTTCTGGTGAGCATTTTGCTCTTTACCTAAACCTGTGCAACCAAATTCCTTGTGTCCCTAGCATAATCCACGAGGTCTTTGAGATTACAATAAAATACAAG