Transcript asmbl_15029

Sequence
Transcript Sequence for observation asmbl_15029 of TGE0032032:
TCGGAACCGGAAGTTGAGCCTGGGAGCCTTGACGTTAGGAACGAAGTCGAACCTGGATCTGGAGCCGGGTGAGATCAAATCGGGGATGCTCTCATAATGAATGTCAACCAGTCAGCTCCACCTGTTCCACCATATGGGCAGAACCAGCCCATCTACCCAGGGTATCATCAGTCGAGTTATGGTGGGCAACCAGGACCTGCAGCCCCTGCTACTCCCTATGGAGCCTACAATGGCCCAGTGCCAGGTTATCAGCAGGCACCTCCTCAAGGTGTGCCAAGAGCCCCACCTTCCTCAGGGGCACCTCCAGCCTCTGCAGCACAGGTCCCTTGTGGTCAGACTACATATGGCCAGTTTGGCCAAGGTGATATACAGAATGGGCCGAGTTCCACAGCTCAGATGCAAAGGGTCCCTGGTTCTCAGCAGTTTGGTCCTCCATTGGCCCCTGTGGTCAGCCAGCCAGCTGTGCTTCAGCCCTATGGCCCTCCCCCCACAAGTACACAGGTGACTGCACAGCTGGCCGGAATGCAGATCAGTGGTGCTGTGGCCCAGGCCCCTCCCCCTTCTGGGTTGGGCTATGGTCCACCAACATCATTGGCCTCAGCCTCAGGAAATTTCCCTAATTCTGGTCCATACGGCTCCTATCCTCAGAGCCAGGCTCCTCCCCTTAGCCAGGCTCAAGGTCATCCTGGAGTCCAGCCTCCCCTTCGATCTGCCCCACCTCTGGCTTCCAGCTTCACGTCCCCAGCTTCAGGTGGTCCTCAGATGCCTTCCATGACTGGACTACTCCCGCCTGGACAGGGCTTTGGGAGTCTTCCAGTGAACCAGGCTAACCACGTGTCCTCACCTCCTGCTCCTGCTCTGCCCCCGGGCACCCAGATGACTGGGCCCCCAGTACCACCGCCACCACCTATGCACTCCCCTCAGCAGCCTGGTTATCAGCTGCAGCAAAATGGTTCCTTTGGACCAGCTCGAGGCCCTCAACCTAATTATGAGAGCCCATACCCTGGAGCACCTACCTTTGGCAGTCAGCCTGGGCCTCCCCAGCCATTGCCTCCTAAGCGTCTGGACCCTGATGCCATCCCCAGCCCTATTCAGGTTATTGAAGATGATAGAAACAACCGGGGTTCAGAGCCATTTGTTACTGGTGTACGGGGACAGGTGCCACCTTTAGTCACCACCAATTTCCTGGTGAAAGACCAAGGGAATGCAAGTCCCCGCTACATTCGATGCACATCCTATAATATCCCTTGTACTTCTGACATGGCTAAACAGGCTCAGGTGCCTCTGGCCGCTGTCATTAAACCACTGGCAAGGCTGCCTCCAGAGGAGGCTTCACCGTATGTTGTGGATCATGGAGAATCTGGCCCCCTGCGCTGTAATCGCTGCAAAGCATACATGTGCCCTCTCATGACATTCATCGAGGGAGGGAGGCGCTTCCAGTGCTCCTTCTGCAGTTGTGTCAATGATGTTCCCCCCCAGTATTTTCAACATCTGGATCATACCGGCAAACGTGTGGATGCTTATGACCGTCCTGAGCTGTCTCTGGGATCTTATGAATTCTTGGCTACTGTAGATTACTGTAAGAACAATAAATTCCCTAGTCCTCCTGCCTTCATCTTTATGATTGATGTCTCCTACAATGCCATCAGAACTGGTCTTGTTCGGCTCCTCTGTGAGGAGCTCAAGTCACTCTTAGACTACCTACCTAGGGAGGGTGGAGCAGAAGAGTCAGCAATCCGAGTTGGCTTTGTCACCTATAATAAAGTGCTCCACTTCTACAATGTGAAAAGCTCCTTGGCTCAGCCACAGATGATGGTTGTATCTGATGTAGCTGACATGTTTGTGCCACTGCTGGATGGCTTCCTAGTCAATGTCAGTGAGTCTCGGGCTGTTATCACCAGCTTATTGGATCAGATTCCAGAAATGTTTGCAGATACAAGAGAGACAGAGACAGTGTTTGCTCCAGTTATCCAGGCCGGGATGGAAGCTCTGAAGGCTGCTGAGTGTGCAGGAAAGCTGTTTCTGTTCCACACATCCTTGCCCATTGCAGAGGCCCCAGGGAAGCTGAAGAATAGAGATGATAGGAAGTTGATCAACACAGACAAGGAGAAGACTCTGTTTCAGCCTCAGACAGGTACCTATCAGACTCTGGCCAAAGAGTGTGTGGCCCAAGGCTGCTGTGTGGACCTCTTCCTCTTCCCTAACCAATATGTCGATGTGGCCACACTCTCTGTTGTTCCCCAGCTCACTGGAGGCTCTGTCTACAAATATGCCTGCTTCCAGGTGGAAAATGACCAGGAACGGTTCTTGAGTGACCTGCGTCGGGATGTACAGAAGGTGGTTGGCTTTGATGCTGTTATGCGGGTTCGGACAAGTACTGGTATCCGTGCTGTAGATTTCTTTGGCGCTTTCTATATGAGCAATACAACAGATGTGGAGTTGGCTGGATTGGATGGAGACAAGACAGTGACTGTGGAATTCAAGCATGATGACCGGCTCAATGAAGAGAATGGAGCCCTACTGCAGTGTGCCCTGCTTTATACCAGCTGTGCAGGGCAGCGTCGGCTCCGCATCCACAACTTGGCCCTAAACTGCTGCACCCAGCTGGCTGATCTGTATCGAAACTGTGAGACTGACACGCTCATCAACTACATGGCCAAGTTTGCATACCGGGCTGTTCTGAATAGTCCTGTGAAGACTGTCCGTGACACTCTCATCACCCAGTGTGCCCAGATCCTGGCCTGTTATAGAAAGAACTGTGCCAGCCCTTCTTCTGCAGGACAGTTGATTCTTCCTGAGTGCATGAAGCTCCTCCCAGTTTACCTGAACTGTGTGTTGAAGAGTGATGTTCTGCAGCCTGGAGCTGAGGTCACTACTGATGATCGTGCCTATGTTCGGCAGCTGGTTTCCTCCATGGATGTGGCTGAGACCAATGTCTTCTTCTACCCTCGGCTCCTACCACTGACAAAGTCTCCCCTTGATAGTACCGCTGAACCACCAGCAGTTCGAGCCTCTGAAGAGCGCCTAAGCAGTGGCGATATATATTTGCTGGAAAATGGGCTCAACCTCTTTGTCTGGGTGGGAGCAAGCGTCCAACAAGGTGTTGTCCAGAGCCTTTTCAACGTGTCCTCCTTCAGTCAGATCACCAGCGGCTTGAGTGTTCTGCCAGTTCTGGATAATCCACTGTCTAAGAAAGTTCGAGGTCTCATCGATAGCTTACGGGCACAGAGAATGCGGTACATGAAGCTTATCGTGGTCAAGCAGGAAGACAAGCTGGAGATGCTGTTCAAGCACTTCCTGGTGGAAGACAAGAGCCTAAGTGGAGGTGCATCCTATGTGGACTTTCTCTGTCATATGCACAAGGAGATCCGGCAGCTACTGAGCTAAAGCAAGTGGGTAAATGGCATAGGGTCCCAGGCCAGCTTCCAGGAAGAACCCCAGGATGACAGAGAAATTGGGACAGTTCCATATCGTATAAGTCATGTAAGCTGACCTCAGTTGACTTCTTTTGGGGGGAGGGCGAGATATAAGGAGACACCGTCTTTCTGGGCTCAAATACACTACCACTCTGTCATGTCCTGCTGATCGAAGGTGCCTCAGGCCCCTTACTCTACCCTTTCTCCTGCTAATCCTCTTGTAATGAATGTAGTTTCTCAGTTCACTGTATATGATTCGGTGTTGGGGGTTTGGAGGCAGCTGGGCCCTGGCAACAGTGTGTCCCTTTGGATGAGCCTCCAAGAGGAAGGGCAGGCAGGAAGAAGTGGGAATCCCAGGGTTATTACAGGAGGTGGCAAATTCAGCTCCGTGTCATCAACAACTTCCTATATTAGGGACAAAATATACAGGTGCACAAGAGCTGGGGTACAGGCCGTAGGTGGTGGAGAGTAAAATAGTTGGTCCTTTGGGTGCCTGATGGTCAGTAGCAAAGTCATAGTTACCGAGGATGGATGACTAATCTCTCTACTTCCACTGCGCGTGCTCTCTCTCCCCTGCAATGATTGGTGAGCACTTCGTGGATGAATGAGCCTGGGGTAAGAATTGCAAAACATATTAACACCTTGGGGAAGTAGCAGCCTCCTTTCCAGATGGAGAAGCCCCAATCCTGGATGGTTCTGTAGAGCGCCTGATGGTCAACTTGCAATACCTCACAGAGCCAGCCCACATCCCACTCAGCTTCCACCAGAAACGTTGTTGGGGAGAGGCAGATATGGCTGGAGCCCTGTCTTCCGGTGCCAGGACGTTACTGGGCTTTGGTATTGACTGAGTGGCTGACAAGTTATCTTCCAACTCCAGTTGGCTGGGCAGGACAAGGGCTAGGAATGACCGTGGTCAGGCCTGCCTGCTCCCAGCCCAGGATGCCCCTGCTAT