Transcript asmbl_13948

Sequence
Transcript Sequence for observation asmbl_13948 of TGE0031172:
GCCTTTTGTAGCAGAAATAAAAGACAAAGACTTAGCCTCCGAATCCGTAGAGGGTGCGGCCCTGGCGCTTGAGCGCGTAGACCACGTCCATGGCGGTGACGGTCTTGCGCTTGGCGTGCTCCGTGTAGGTGACGGCGTCGCGGATCACGTTCTCCAGGAACACCTTCAGCACACCGCGGGTCTCCTCGTAGATGAGGCCGGAGATGCGCTTCACTCCCCCGCGCCGGGCCAGGCGGCGGATGGCGGGCTTCGTGATGCCCTGGATGTTATCGCGCAGCACTTTGCGGTGGCGCTTGGCGCCGCCTTTGCCCAGGCCTTTTCCTCCTTTGCCACGACCAGACAT