Transcript asmbl_13601

Sequence
Transcript Sequence for observation asmbl_13601 of TGE0053524:
GACTCTGCATCATGAATACTCTGTCTGAAGGAAATGGCACCTTTGCCATCCATCTTTTGAAGATGCTATGTCAAAGCAACCCTTCCAAAAATGTATGTTATTCTCCTGCGAGCATCTCCTCTGCTCTAGCTATGGTTCTCTTGGGTGCAAAGGGACAGACGGCAGTCCAGATATCTCAGGCACTTGGTTTGAATAAAGAGGAAGGCATCCATCAGGGTTTCCAGTTGCTTCTCAGGAAGCTGAACAAGCCAGACAGAAAGTACTCTCTTAGAGTGGCCAACAGGCTCTTTGCAGACAAAACTTGTGAAGTCCTCCAAACCTTTAAGGAGTCCTCTCTTCACTTCTATGACTCAGAGATGGAGCAGCTCTCCTTTGCTGAAGAAGCAGAGGTGTCCAGGCAACACATAAACACATGGGTCTCCAAACAAACTGAAGGTAAAATTCCAGAGTTGTTGTCAGGTGGCTCCGTCGATTCAGAAACCAGGCTGGTTCTCATCAATGCCTTATATTTTAAAGGAAAGTGGCATCAACCATTTAACAAAGAGTACACAATGGACATGCCCTTTAAAATAAACAAGGATGAGAAAAGGCCAGTGCAGATGATGTGTCGTGAAGACACATATAACCTCGCCTATGTGAAGGAGGTGCAGGCGCAAGTGCTGGTGATGCCATATGAAGGAATGGAGCTGAGCTTGGTGGTTCTGCTCCCAGATGAGGGTGTGGACCTCAGCAAGGTGGAAAACAATCTCACTTTTGAGAAGTTAACAGCCTGGATGGAAGCAGATTTTATGAAGAGCACTGATGTTGAGGTTTTCCTTCCAAAATTTAAACTCCAAGAGGATTATGACATGGAGTCTCTGTTTCAGCGCTTGGGAGTGGTGGATGTCTTCCAAGAGGACAAGGCTGACTTATCAGGAATGTCTCCAGAGAGAAACCTGTGTGTGTCCAAGTTTGTTCACCAGAGTGTAGTGGAGATCAATGAGGAAGGCACAGAGGCTGCAGCAGCCTCTGCCATCATAGAATTTTGCTGTGCCTCTTCTGTCCCAACATTCTGTGCTGACCACCCCTTCCTTTTCTTCATCAGGCACAACCAAACCAACAGCATCCTGTTCTGTGGCAGGTTCTCATCTCCATAAAGGCACATTACTATGTGGGGTGAGTTCACACTCCAGCATCTCCACCACTCCTACAGCTCCGTGAGAATGGGCAAACAGAGGGAATCCATGTTCTAAGATGAAGGCACTTTCTCCCTGTCAGCCTGATCTTATGATGCCTGCTTTCACCTTTCCCTGTCCTGAATGCACCTGTGCCCTCTGCACAGTTATGTCTAACCATGCCATATACCCTCTGCTATGCCACTGATACCCATAACTTAAAGTCAATTATGTAGAACCAGTTAGAAGTGATTTCACCGTACAAGTCTTGTTACTCTTGCAGAGGACCAAGGAATATTTCCCACCACTCACCTGACTGCTCACAAGCCCTGAAATTCTAGTTTCCCATCTATTACTTGATTTTTTATTTTATTTTATTTTTTTT