Transcript asmbl_13400

Sequence
Transcript Sequence for observation asmbl_13400 of TGE0036026:
CGGAACAACATGGCTACAGTGTTTCGGCCCCTGGAACGCCTGCGGGTGCCGCGTCCTTCGCTGCATCCCGGGGTGACGGGCTCAGGCTCCGCCTGCTGCCGCTGCACTCTCGGAGCTAAAAGATACCTACTCACAGATAACATTGTGAAGTTAAAGGAATTTCAACATAAGAAGATAGCTATTGCATATAACCTACCTGGCACCAAAGAAATCTATTTCAGAAACTTGGAAGAGAAGTTGACCCAGAACAAACTCATCTTGAAGGAAGAGTTGAAAACGCTGCTGTACCTGTGCCAGTCCCTGGAAGATGTGCAGCTGGCGAAAGCCGTCATTTATAGGTACCATGCAGAAAACAAGAATTTCACTTTGGGGGAATACAAGTTCGGACCAGTTTTCATGAGGCTGTGCTACGAGCTGGACCTGGAGGACTCTGCAGTGGAGCTCGTCAGAGACAAGCATCTACAAGGCTTCTTCCTAGATTCAACGTCATTCAATATTTTGATGGATATGTTATTTACCAAAGGCAAATATGAACGTGCACTTCAAGTGTTGATCGAAATGAAAAACCAAGATGTGAGGTTCAGCAAAGAAACCTACATCCTCGCTTTTGCAATCTGCTACAAACTGAATACCCTGGAATCGCTTAAAATCTGTACTACGTTAAGAGAAGAAGCCCTAATTAAGGGAGACATTATCTGCAGGAGAGCATACTGTTTTGTAGTGGCATTAGCTCTGAATAAGAACCAGTTGAAAAACGCTGTGTCCATTTTTTCTCAAATCGTGAATCCAGAAAGCATAGTGTGTATTAACTTAAATATCTTGATCCACATCCAGTCAAATATGTTGGAAAGCCTGTTAAAGATCTTAGAGGACTCTCTTGACACAAATTTATCGAAATTTGTAAGAAGACACACATTCTCAGAGGAAGTGCTGGCCAAAGTGAGGGAAAAACTGAAGGACAGCCCTGCACTCATAGCCAGATTCGATGAGGTCTATGGGAAGCTGCACGTGAACGGTCAAATCACCGTTCATTCTTTGGATGCTCTGCTCTGCCACGTCCCCCGGGACAAGAGATCCAACTTGTTGCTGTTAAAGAAGAGGGCAGTCAGCCACCGGACCTTACAGCCTCTCAGCCGGTCCCTGCTGACCGAGTAACTGCTTTCCATTTCCCTGGTCTGGAGCAGCTGCTGCTACAGTGGATTACTGGCTGCTCCGGGCCGGGCATCTTACTTACTTCAGTGGCCCTGTGCTGACGCTTGGTCTCCCTAAGTCCTAAGTCCCCCGAGTGGTGACATGCTACCAGAGAAATGGGAAGAGCTAGCTCGAGCCAAGGGAGCCCCACAGAAAGGCAGCTGCCCTCGTTTCACAGGCTCCAGAGTAAGACTCAGAGCTGCTAATGCAGCCCAGTAGAGTGGAGCTCAGGAGGTACCCACAGACGGGATTTCTCTTGGTCTTGACTGACCTTTCACGGCAGAGGTGACTCGCAAGTTGGTGGGGAGACCTGAAACCCTCATCTCCCATCTTTGGAAGTGGCGGAGGCCTTCCTCGTCTCCGCCATCGTTATTCCATCTGTGAGGCGATGCTGCCTGGGTGTGCTTGGATGACTTCACATTTCCATTCAAGGTTCAGTAGAGTTCAGCTTTCTCCAGAATAAGAAATAAAAGGTTCCTGTGCAGA