Transcript asmbl_13124

Sequence
Transcript Sequence for observation asmbl_13124 of TGE0031913:
TGCCCTGCAGTTTCTGCTGGGCCTAAGCCTCCGGGCTCAGTTTGACCACAGTATCTAGCTATGGCGGCAGTGACCTGGAGTCGGGCTCGATGCTGGTGTCCGAGGTAAGCTTGCAGCCTCGACTCTCCGGCCCAAAGTCGCCAGCGGGAATTTTCGCCCGCCCACGGAGCCGCCCGCTTTGTCATCTGGCCTGGCTAGCGAGACAGCAGGATATTACTTTGACGATTTCCCAGCGAGAGAGCTCTAAAGAGTGACCTCGAAGGTTCTTCCTCTGCTGAGTCCCAAAGGATGCATGCTGTTCTGATCAACATGAGTTGGAGCCAATCAGTAATCCTGTTGCTGCAGAAATAAAAGGGCAAGGAACAAACAGAAACCACTATTTGTAGTGTCCTGCAGGTCTTCAGATTACAAGTGGCTAAACTGCACTTGGGCAGACCAACAATGAGAGCCAGTCAGCAGGACTTTGAAAATGCATTGAACCAGGTGAAACTCTTGAAGAAGGACCCGGGAAACGAAGTGAAGCTAAGACTCTATGCACTGTACAAGCAGGCCACAGAAGGACCCTGTAATATGCCTAAGCCTGGTATGCTTGACTTTGTCAACAAAGCCAAGTGGGATGCATGGAATGCCCTGGGCAGCCTACCCAAGGAAACTGCCAGGCAGAACTATGTGGATCTCGTATCCAGTTTGAGTTCCTCATCTGAAGCCCCGAGCCAGGGAAAGCGTGGAGCTGATGAGAAAGCCCGGGAGTCCAAAGACATCCTGGTAACTTCTGAAGATGGTATCACGAAGATCACGTTCAATCGGCCCACCAAAAAGAATGCCATATCCTTCCAGATGTATCGGGATATTATACTCGCACTTAAAAATGCCAGCACTGATAACACTGTCATGGCTGTTTTCACAGGAACTGGTGACTACTACTGCAGTGGGAATGACCTGACTAACTTCACTAGTGCCACTGGGGGGATAGAGGAGGCAGCTAGCAACGGTGCTGTGTTACTGAGGGACTTTGTAAACAGTTTTATAGACTTTCCCAAGCCTCTGGTTGCGGTAGTAAATGGCCCAGCTGTGGGAATCTCTGTCACCCTTCTGGGACTATTTGATGCTGTCTTTGCATCAGACAGGGCAACGTTTCATACTCCATTCAGCCAACTCGGCCAGAGCCCGGAAGCATGCTCCTCTTACACGTTTCCGAAGATGATGGGCTCAGCAAAGGCAGCTGAGATGCTTCTCTTTGGGAAGAAGCTGACAGCAAGAGAGGCCTGGGCTCAAGGCCTTGTCACTGAAGTTTTCCCTGAGAGCACTTTTGAGACAGAAGTCTGGACCAGGCTGAAAACATATGCGAAGCTCCCGCCAAACGCCATGAGAATTTCCAAAGAGTTAATCAGAAAAAATGAGAAAGAAAAGCTCTACGCAGTCAACGCTGAAGAGTGCACTACTCTGCAAGCAAGGTGGCTGTCAGAGGAGTGCATGAACGCAATCATGAGCTTCGTCTCCAGAAAACCAAAGCTGTGAAGACCACCACAGCAGCTAGACTCCTCATAGGGAGCATGGGCTGGGAGGTCCAGTTTCGAGGACTCAAACGACACATGCTTCTCTGTGCCTTTTCCTTGATTAACGTAGCAATTATGATGAGAATTCTTCACAGTACTGATAAATAAAACTTTTCATAAATCAA