Transcript asmbl_8666

Sequence
Transcript Sequence for observation asmbl_8666 of TGE0002306:
GCGTTTCCGTTTCAAAGCCTAACTTCCGGCTCTTCAGCCGGTTCCGGTCCCTGCCTTTCACTTCCGGTCGCCTTCCGCTCTGCTGCGGTCGGTTCCTGCGTCCGCTGCTGCCGGTTCCGCCACGCTGCAGGTATTTTTTCCTGAACAAAAGCTGCCTCAACCTATGTTTCAAGGATGGCTCTCCCTATCATTGTAAAATGGGGTGGACAGGAATATTCAGTGACCACACTTTCAGAAGATGATACTGTGCTAGATCTCAAACAGTTTCTCAAGACGCTCACAGGAGTGCTACCAGAACGCCAAAAGTTGCTTGGACTTAAAGTTAAAGGCAAACCTGCAGAAAATGATGTTAAGCTTGGAGCTCTCAAACTGAAACCAAATACTAAAATCATGATGATGGGAACTCGTGAGGAGAGCTTGGAGGATGTCTTAGGTCCACCTCCTGACAATGATGATGTTGTCAATGACTTTGATATTGAAGATGAAGTAGTTGAAGTAGAAAATAGGGAAGAAAACCTACTAAAAATTTCTCGCAGAGTAAAAGAGTACAAAGTGGAAATTTTGAATCCTCCCAGGGAAGGGAAAAAGCTTTTAGTACTTGATGTGGATTATACATTATTTGACCATAGGTCTTGTGCAGAGACTGGCGTAGAATTAATGCGGCCATATCTTCATGAATTCCTAACATCTGCATATGAGGATTATGACATTGTTATTTGGTCTGCAACAAATATGAAGTGGATTGAAGCTAAAATGAAAGAGCTGGGAGTGAGCACAAATGCAAATTATAAAATTACCTTCATGTTGGACAGTGCTGCTATGATAACAGTGCATACACCAAGGAGAGGATTAATAGATGTAAAGCCTCTTGGTGTTATATGGGGAAAGTTTTCGGAATTTTACAGCAAAAAAAACACCATTATGTTTGATGACATAGGAAGAAATTTTCTAATGAACCCACAGAATGGACTAAAGATAAGGCCTTTTATGAAAGCGCATCTAAATCGAGATAAAGACAAAGAACTTTTAAAATTAACTCAGTACCTCAAGGAAATAGCAAAATTGGATGACTTTTTGGACCTAAATCACAAATATTGGGAAAGGTATCTCTCAAAGAAGCAAGGACAGTAGTTACAAGTTATACTGGCAGTTATTGAAGATACTTGAGATCCATGAACTTCTTGCTTTAATGCTAGAAATCATTATAATAGTGCTGGACACTGAAGCAAATACCAGACTGCTTATACTTGGTCTTCCAGTTTTTTGTAAATTTAATTTTATATTTTTTGAAGCTCATGGCAATATGCTAAAAAACAAAAACAAACAAACAAAAAACCCTTTTTTCCCCGGTAAGAATATACTGTTACTCTTGAAAAATATTTTCTCCAGCATTGAGTACTGAGTTTTTTTTCCCACATACACAAAAAAAAGTGGACAAAAATGTATATTCAACAATGTCATTTTGTGACTTTGGAAACAAGTTATGTCTTGTGTTTTTGCCTCCTTGTGGTGTTTGACTAAATCTTAGACCAAACCCATCTTGAAAACTACTGCTCTTCCTTTTAAAACCAAAAAATATCTTTTGAGTAAGGAACCTAGTTTGGTGTTTAAGTTAAAGTCACCAAGAGTTTTTTTCATTCCTTTGTCATAGACACAGTTTCTCTTCTTGCTCCACTATTTACATATCTAAATTCTGAGCTGTCTCAGTTTGGTCTGTATGTGTATCCATGTTCTTTGAGTAAAACTGGAAAATGTCAGCCGTGATACAGATATGTCATAGTATGAAAATTAGAAAACAAGACTGAAGAATAAAATTAAGGAACGAGAGTTTCTTTTTGGTGACTAAGTAGAAGCACTTCTGCCTAAAACCATTGTCATAAAAGCAGTTAAAGGCAATACATTTTTAAATGGGACAAATCATCGATTAAGCCCTAGAAAGCATGAACAAAAAGGTTTTGTTCTGTTCCAGCTATACCTTGTCTAAGTGCAAACACTGTTTCAGTGGAAATATCTAGCCATAAGCTTTAAAAAATTATTTGCAATGCTTAAGCCTGCAGATGTGTAATGTGGCCACTGTTTTGTGTTAACAGTATTGCTTTATACAGTTCTTGTATTTGAAAGGAATCTGATCCTTTCACAGGAACATGGTATATATCGTTCTTACGGGACTATTTCAGTGGTGTAAATAATAAATACCTTTTCTTAAAA