Transcript asmbl_11980

Sequence
Transcript Sequence for observation asmbl_11980 of TGE0031860:
CCGGCGGTGGCGATTTGGAGGACTGAAGGAAGATGGGTCAAAGCCAGAGTGGTGGCCATGGTCCTGGGGGTGGCAAGAAGGATGACAAGGACAAGAAAAAGAAATACGAACCTCCTGTCCCAACTAGAGTGGGGAAAAAGAAGAAGAAAACAAAGGGACCAGATGCTGCCAGCAAACTGCCACTGGTAACACCTCACACCCAGTGCCGCCTGAAATTACTGAAGCTAGAGAGAATAAAAGACTATCTTCTCATGGAGGAGGAATTCATTAGAAACCAGGAACAGATGAAACCATTAGAAGAAAAGCAAGAGGAGGAAAGATCAAAAGTGGATGATCTCAGGGGGACCCCCATGTCTGTAGGAACCTTGGAAGAGATCATTGATGATAATCACGCCATTGTGTCCACATCTGTGGGCTCAGAACACTACGTCAGCATCCTGTCGTTTGTAGACAAGGATCTGCTGGAACCAGGCTGCTCCGTCCTGCTCAACCACAAGGTGCATGCTGTGATAGGGGTGCTAATGGATGACACGGATCCCCTGGTCACAGTGATGAAGGTGGAAAAGGCCCCCCAGGAGACCTACGCAGATATTGGGGGACTGGACAACCAGATCCAAGAAATTAAGGAGTCTGTGGAGCTCCCGCTTACCCATCCTGAGTATTACGAGGAGATGGGGATAAAGCCCCCTAAGGGGGTCATTCTCTACGGTCCGCCAGGAACAGGTAAAACTCTATTGGCCAAAGCAGTAGCGAACCAGACTTCAGCCACTTTCTTGCGAGTGGTTGGCTCAGAGCTTATCCAGAAGTACCTAGGTGACGGGCCCAAACTTGTCCGGGAGCTCTTCCGGGTCGCTGAGGAGCATGCGCCGTCCATCGTGTTCATTGATGAGATCGACGCCATTGGGACCAAAAGATATGATTCAAATTCTGGAGGTGAGAGAGAAATTCAGCGAACAATGTTGGAACTGTTGAACCAGTTGGATGGATTTGATTCGAGGGGAGATGTAAAAGTTATCATGGCCACAAACCGAATAGAAACTTTGGATCCAGCACTTATCAGGCCAGGCCGCATTGACAGAAAGATCGAGTTCCCCCTGCCGGATGAGAAGACCAAGAAGCGTATCTTCCAGATTCACACCAGCAGGATGACACTGGCTGATGATGTAACCTTGGATGACTTGATCATGGCAAAGGATGACCTCTCTGGGGCCGACATCAAGGCAATCTGTACAGAAGCTGGCTTGATGGCCTTGCGGGAACGCAGAATGAAAGTAACAAATGAAGACTTCAAAAAATCTAAAGAGAATGTTCTTTATAAAAAACAAGAAGGCACCCCTGAGGGGCTCTATCTCTAGTGGCCCACAGTCGTCCTCAGGGATGGGGAGCTGTCCCCAGGAACCCATTCTCCAGTTCAGGTTTGCCAGTAGAAAGCCTGTATCGTGGAGGACACTGTGCCTCCATCTGTTGTTGGTCATTGTGCCGTGCTGCTCTCTACTCCCAATAAAGGATTGGCCTGGTTTGCTTTCTAGCACTGTAATGAGTACCATGATAAAAAAACAATTTGGAGCTTGAGGGAAGAGTTCA