Transcript asmbl_11119

Sequence
Transcript Sequence for observation asmbl_11119 of TGE0039097:
GCCAATCTGCCTGCCATTGCTTTCTGGATATGGATTAACAAACATCCTTGCAGAGATTAGATTTCACTGCTACCACCCTGCTCCTGCCATACTGAATAGAAGGCCCCAAATCAGAGTTTGGACAGGAGTCGGAAAATACAGATCCGCAATATTCCACCTCAGCTCCGATGGGAAGTGCTAGATAGCCTGCTGGCTCAGTACGGTACAGTGGAGAACTGTGAGCAAGTGAACACTGAAAGTGAGACAGCTGTGGTCAACGTCACCTACTCTAACCGGGAGCAGACCAGGCAAGCTATCATGAAGCTAAATGGCCATCAACTGGAGAACCATGCCCTGAAGGTCTCCTACATACCTGATGAGCAGATAACGCAAGGTCCTGAGAATGGGCGTCGTGGAGGCTTTGGGTCTCGGGGCCAGCCCCGGCAAGGGTCGCCCGTGGCAGCAGGGGCTCCAGCCAAGCAGCAGCCAGTGGACATCCCTCTCCGGCTCCTGGTGCCTACGCAGTATGTAGGCGCTATCATTGGCAAGGAGGGTGCCACCATCCGAAACATCACAAAACAGACGCAGTCCAAAATAGACGTGCATAGGAAGGAGAATGCGGGCGCTGCGGAGAAGGCCATCAGCGTGCATTCAACCCCTGAAGGCTGCTCCTCCGCGTGCAAGATGATCTTGGAGATTATGCACAAGGAGGCAAAGGACACCAAAACGGCAGATGAAGTTCCCCTGAAGATCCTGGCTCATAACAACTTCGTCGGGCGACTCATTGGCAAGGAAGGGCGGAACCTGAAGAAGGTGGAGCAGGACACAGAGACGAAGATCACCATCTCATCGCTCCAGGACCTCACGCTCTATAACCCTGAGAGGACCATCACTGTGAAGGGCGCCATTGAGAACTGTTGCAGGGCCGAGCAGGAGATCATGAAGAAAGTTCGAGAGGCTTACGAGAACGACGTGGCCGCCATGAGCTTGCAGTCCCACCTCATCCCTGGGCTTAACCTGGCTGCTGTAGGTCTCTTCCCAGCTTCATCCAGCGCTGTCCCTCCTCCTCCCAGCAGTGTCACCGGGGCTGCTCCCTATAGCTCCTTCATGCAGGCTCCGGAGCAGGAGATGGTACAAGTGTTCATCCCCGCCCAGGCTGTGGGCGCCATCATTGGCAAGAAGGGCCAGCACATCAAACAACTCTCCCGCTTCGCCAGCGCCTCCATCAAGATTGCACCACCAGAAACACCTGACTCCAAAGTTCGAATGGTCGTCATCACTGGACCCCCAGAGGCTCAGTTCAAGG