Transcript asmbl_11067

Sequence
Transcript Sequence for observation asmbl_11067 of TGE0031758:
GCTGGGGGTTGAGGGTGAGGACTATAGAAGGCTCTGAGCACTGGGCTCAGGGTTCATCTGGACAGAGTAAGCAAGCTCATCAGGCCGGTCCTGGGGCGGCGAGTCCTGAGCTGGGCAGGTAGGGCTCCTTCCTCAGCTGTGCCACCAGCTGTGGCTTCTGGCCCCAGATCCGGGTAAACTCCGTAAACCCCACTGTGGTGCTGACTGACATGGGCAAGAAAGTCTCTGCAGACCCTGAGTTTGCCAGGAAGCTCAAGGAGCGCCACCCACTGAGGAAGTTCGCAGAGGTTGAAGACGTCGTCAACAGCATCCTCTTCCTGCTCAGCGACAGAAGTGCCTCTACCAGTGGCGGTGGCATCCTGGTGGATGCTGGCTACCTGGCCTCCTAGTCTGCTCAGTTGCCGCGGACATCTGAGTGGCCTTCTTAGCCCCACCCTCAGCCAAAGCATTTACTGATCTCGTGACTCCGCCCTCATGCTACAGCCACGCCCACCACGCAGCTCACAGTTCCACCCCCATGTTACTGTCGATCCCACAACCACTCCAGGCGCAGACCTTGTTCTCTTTGTCCACTTTGTTGGGCTCATTTGCCTAAATAAACGGGCCACCGCGTTACCTTTAA