Transcript asmbl_11042

Sequence
Transcript Sequence for observation asmbl_11042 of TGE0031751:
TGACCGTCCGAGCGGCGGGCGGCGGACGACGTTCGTCATTTGGTGCGGGAGGGAGCGCGAGAGCGGCGGTCGAGCCTCCGGTGTCCCAAGCTAGAGGTAAGCATGGCAGAACAGGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGAGAATGAGGAAGATGAGCACTCTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGGACGATGAAAGCCTCCGAAAGTACAAGGAGGCCCTGCTGGGCCGAGTAGCTGTCTCTGCAGACCCCAACGTCCCCAATGTCATTGTGACTCGACTGACCTTGGTATGCAGCACTGCCCCAGGCCCTCTGGAACTGGACCTGACAGGTGATCTGGAGAGCTTCAAGAAACAGTCGTTTGTCTTGAAGGAAGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTGAACAGAGAGATCGTGTCCGGCATGAAGTACATCCAACACACATACAGGAAAGGGGTCAAAATTGACAAGACTGACTACATGGTCGGGAGCTATGGGCCGAGGGCCGAGGAGTATGAGTTCCTGACACCCATGGAGGAGGCTCCCAAAGGCATGCTTGCTCGGGGCAGTTACAACATCAAGTCGCGCTTCACAGATGACGACAAGACTGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAAAAGGAGTGGAAGGACTGAGCTCCAGCTGGGAGACGGGCAGGGCGACGGACAGACAGAAGGACCGACATGCCCCACCCTAACCCCCTACCTACCCCAAACCAAAGTGCTGACAGGACCTCCCTCACCCGTCATTCCTCCCTAGTCCACTCAGGCAGTCAGCTCTCCTGTCTGCCCCTCCTCCACCTCCTGCCCGCAGGCCCCTGTGGTCTCCAGTGTCACATTGCTGCTTCTGCCTGTGCAGTGGGGGAGGGGTTCCAGCCCAGGCCTCCAATCTGCTGTGTCCCTCCAGGTTCCCTCTGTCTTCCCTTCCTCAGGCCCTGGCTTCTAGAATGGAACAGAACACTGTCAGGGTTGTCCAGCCCACCTTGTCTCTGTCGCAGCATGGGGAAGGGCTGGGCTATCTGTCCTCTAGTCCCACCACTCCCTGGCCAGGTCATCCATCACTGTCAGTCACTGTCTAACCATGATGCCTTAACATGTGGAACGTGTGCTGGGGGCCGTCGCTAACTCTTAACTCCCTGTCTGCATGAGCATGTGCTCTCCCTGTCCTCGCCTCGTCTGCCATCCCCATCCCAGTGACCCACCCAAGGGAGGCCTGGGGTGCGCTGCTGTTGCTTCCTGCGAGCCTGGCCAGCTCTTCCCCTCCCCGTGGCCAGGGTTGGGGGTGGCTCCAGTAGCTAGGGGAGGGTCAATTGCCAAAACTCGATGCCTCCAGCCCCATCTAGGAGGCAGGGTAGGGTGCCTCATTCCTCTGCCTTCTCTGTCCCTTGTAGGCAGTACTCGGAGCCCCTGTCCCCACAGAGAGCCCCTGAGGGACAAAGCCAGCCGAGCCTTACTTGTCTCACCTGGGCCACGTGGCCTGAACCTCGTGCCTGGCCTGTCAGTATTTATTGCCTCCATTTGGGCCAGCTGGCCTGATGCCTCTGCCCTGGTTCTTGGTGCCACCATCCCTGGGCCGACCCTCCCTGGACCCAGCCAGGACAAATGTGGGACCAAGTTCACACAGTTGGGAGCTGTCTCCTGTGCCTCCCCTCCCTATCCCCAGTCCCTGTGTGGTGTCTGCCAGGCCCAGCCTCAACAGGCAGAGGAGCCTGTCCCTGCTTCTCTTCTGACTGGGAAATAAACACCCCTGAAGGAGTC