Transcript asmbl_10657

Sequence
Transcript Sequence for observation asmbl_10657 of TGE0035846:
CTTGGATTGGCTCCGCTGAAGACGGCGACGTGGCTGAAGGAGGCCGGTTTGTTTCGGAACTGAGGCTCAAGCACAGCCGCTCAGGATTGGTGCTAGGCTGGGCCGGGGTCTTTGGCCGGAAGCGGAAGTGGAGAAAGGATGCAGGACCATCAGCACGTGCCCATCGACATCCAGACCAGCAAGCTGCTCGACTGGCTGGTGGACAGAAGACACTGTAACCTAAAATGGCAGAGCCTGGTGCTGACCATCCGGGAAAAAATCAACACTGCCATCCAGGACATGCCAGAGAGCCAGGAGATTGCCCAGCTGCTCTCTGGATCCTACATTCATTACTTCCACTGCCTAAGAATAGTGGACCTTCTTAAAGGCACCGAGGCGTCCACCAAAAATATTTTTGGCCGGTACTCTTCACAACGGATGAAAGATTGGCAGGAGATCGTAAGCCTGTATGAGAAGGACAACACCTATTTAGTGGAACTCTGTAGCCTCCTGGTTCGGAATGTCAGCTATGAGATCCCCTCGCTGAAGAAGCAGATTGCCAAGTGCCAGCAACTGCAGCAAGAATACAGCCGCAAGGAGGAGGAGGGCCAGGCTGGGGCCGCTGAGATGCGAGAGCAATTCTACCACTCCTGCAAACAGTATGGCATCACGGGAGACAATGTCCGAAGAGAACTTCTGGCCCTGGTGAAGGACCTGCCAAGTCAGCTGGCTGAGATAGGGGCAGGGGCTCAGTCCCTGGGGGAGGCCATTGACCTGTACCAGGCCTGTGTGGAGTTTGTGTGTGACAGCCCCACAGAGCAAGTGCTGCCCATGCTGCGGTATGTGCAGAAGAAGGGAAACTCGACGGTGTATGAGTGGAGGACGGGGACAGAGCCCTCTGTGGTGGAGCGACCACAGCTGGAGGAGCCTCCTGAGCAGGTGCAAGAGGATGAGATCGACTGGGGTGACTTTGGGGTGGAAGCTGTTTCCGACTCTGGCATCGTTGCTGAGACTCCTGGAATAGACTGGGGTATCTCCCTGGAGTCAGAGGCCAAGGATGCTGGGGCTGACAAGATAGACTGGGGTGACGATGCTGCTGCTGCTTCAGAGATCACCGTGCTGGAGACAGGAACTGAGGCTCCGGAGGGTGTAGCTCGGGGCTCAGACGCTCTGACTCTTCTGGAATACCCTGAAACTCGGAATCAGTTCATTGATGAGCTCATGGAGCTTGAGATCTTCTTGTCTCAGAGAGCAGTAGAGATGAGCGAGGAGGCCGACATCCTGTCCGTGAGCCAGTTCCAGCTGGCTCCTGCCATCCTCCAGGGCCAGACCAAAGAGAAGATGCTCAGCCTGGTGTCCACGCTGCAGCAGCTGATCGGCCGGCTCACCAGTCTGCGGATGCAGCACCTGTTTATGATTCTGGCCTCGCCAAGGTATGTGGACCGAGTGACAGAGTTCCTCCAGCAGAAGCTGAAGCAGTCGCAGCTGTTGGCTTTGAAGAAGGAGCTGATGGTGGAGAAGCAGCAGGAGGCGCTTCAGGAGCAGGCAGCTCTGGAGCCCAAGCTGGACCTGCTGCTGGAGAAGACCAGAGAGCTGCAGAAACTGATTGAAGCCGACATCTCCAAGAGATACAGTGGCCGTCCTGTGAACCTGATGGGGACCTCTCTGTGACGCGCTCCCTCTGTGTCCTCCACCCTCCTTCCCAGCTACCAGGAGGAGGTGGGACAGCCCAGGCTGATGCTACTGGGCCTCACCAGCAAGAAGTCAGGCGGACTTGGAGACAGAGCCATGAGGAAGGGTCACACCATGATCTCTGCAAGCAGTTGTCTTGAGTGGCTCTGGCCTGTCAGCCTTAAGGCACACTTGCTGCTTCTAGTTGTCAAGTGAGGCTTAATAAAAGGAAG