Transcript asmbl_8484

Sequence
Transcript Sequence for observation asmbl_8484 of TGE0007853:
GCCTAGGTCAGGAACATGGCCGCGCGGTCCCTATGGGCGGTCCGGTGGCGGGTACAGCGCCTCTTGTCCTCGAGTGCCGCGTCGGATGGCAGGGGATGTCTGCACCTTTTCAGCACCGCCACCCAGAGAACTGCTGGTGAGGACTGTAATTCTGAGGACCCTCCCGATGAGCTTGGGCCCTCTCTTGCAGAAAGAGCCTTAAAGCTAAAAGCTGTTAAACTAGAGAAGGAAGTCCAGGATTTAACAGTGAGATACCAGAGAGCTGTAGCTGATGGTGAAAACATAAGAAGACGAACTCAGAGATGTGTAGAAGACGCCAAGATATTTGGAATTCAGAGTTTCTGTAAGGACTTGGTAGAGGTGGCAGACATTTTGGAGAAGACTACAGAGTGCATTTCTGAAGAAACAGAGCCTGCAAACCAGAAGCTCACTCTGGAGCAGATATTCCGGGGGTTGTCACTTTTAGAAGCAAAGCTGAAAAGCGTGTTTGCCAAGCATGGCCTGGAGAAGATGACACCCATTGGTGACAAATACGACCCTCATGAGCATGAACTCATCTGTCATGTGCCAGCTGGTGTTGGGGTGCAGCCCGGCACAGTGGCATTGGTAAGGCAAGATGGCTACAAGCTTCATGGCCGCACCATTAGACTTGCCCAGGTGGAAGTGGCAGTGGAATCTCAGAGAAGACTCTGAATGGGCCATGAGGAACCAAATGTTCTTCCAGAGCGCAGTCACCTGTGTTTCCTTTATTTATTAAACTAGGTTTGTACATGAGGTACTTCATGTGATCTGTTTTGGATTTAGTCATATTGGCTTTATTTCTAAGATACTCTATTGATTTAATGTGACCTGTTCGGTCTCATCAGAAGTCTTGCCATTCGGCATTTGAACAATGTGACAAGTGTTTCTATGGCCTTTATGTTTAAGAAAATTATTTTTAAATTAGTTCTCTGAGGACTTTCAATCCAAAATCTTTTTAAAAGTTGGAAATGAGTATATGTTTATGTATTTTGGACTAATTGTTCCTTTCTGATAGTCCTTATAACAGGTATTGCATAGGATCTTGTGTATTTTGTGGGAAAAGAGATTGGTACA