Transcript asmbl_25116

Sequence
Transcript Sequence for observation asmbl_25116 of TGE0000801:
GTGGTGGTGGTGGCGGCGGCGGCGGCGAAGGGGGCGGAGAGGAAGGAGCGCGGCGGGACCGGGCCGGGACAGCGCGTACTTTGGGCTCCGGGATTCGCTCCGCGCCCGCGGTTGTAGCAGCTGCCGCTGCAGCCATAGCAGCAGGTCAGTCATTGGCACCATGAACTGGAATAAAGGTGGTCCTGGCACTAAGCGAGGATTTGGCTTTGGAGGTTTTGCCATCAGTGCTGGGAAAAAGGAGGAACCCAAACTCCCACAGCAGTCCCACAGTGCCTTTGGGGCAACCAGCTCTTCTTCTGGATTTGGAAAGTCAGCTCCACCACAGCTTCCTTCTTTCTACAAAATTGGATCTAAGCGGGCCAACTTTGATGAAGAAAATGCCTATTTTGAAGATGAGGAAGAAGATTCTAGCAACGTTGATTTACCTTACATTCCTGCTGAAAACTCACCAACTCGCCAGCAATTCCATTCCAAGCCAGTAGATTCTGACAGCGATGATGATCCCTTGGAGGCATTCATGGCTGAAGTGGAGGATCAGGCAGCTAGAGACATGAAGAGGCTTGAAGAAAAGGACAAGGAAAGAAAAAACGTAAAGGGTATTCGAGATGACATTGAAGAGGAAGATGACCAAGAAGCTTATTTTCGATACATGGCAGAAAACCCAACTGCTGGTGTGGTTCAGGAGGAAGAGGAAGACAATCTAGAATATGATAGTGACGGAAATCCAATTGCACCTACCAAAAAAATCATTGATCCTCTTCCCCCCATTGATCATTCAGAGATTGACTATCCACCATTTGAAAAAAACTTTTACAATGAGCATGAAGAGATAACCAACCTCACTCCACAGCAGTTAATAGATCTCCGGCATAAGCTCAATCTTCGGGTCTCTGGTGCTGCACCTCCTAGACCAGGAAGTAGCTTTGCTCATTTTGGGTTTGACGAACAACTTATGCACCAGATTCGGAAATCTGAATACACACAGCCCACTCCAATACAGTGCCAGGGTGTGCCTGTGGCATTAAGTGGTAGAGACATGATTGGTATTGCCAAAACAGGTAGTGGGAAAACTGCAGCCTTCATTTGGCCCATGTTGATTCATATAATGGACCAGAAGGAGTTGGAACCAGGTGATGGACCAATTGCAGTGATTGTGTGTCCTACCAGGGAGCTTTGCCAGCAGATCCATGCAGAATGTAAGCGGTTTGGAAAAGCATATAATCTTCGATCAGTGGCCGTATATGGAGGAGGGAGTATGTGGGAGCAGGCCAAGGCCCTTCAGGAGGGGGCAGAGATTGTTGTGTGTACCCCAGGTCGACTGATAGATCATGTGAAAAAGAAAGCTACCAATCTTCAAAGAGTCTCTTACCTTGTGTTTGATGAAGCAGATCGAATGTTTGACATGGGATTTGAGTACCAAGTTCGATCCATAGCAAGTCATGTTCGTCCTGACAGGCAGACTCTCTTATTTAGTGCAACTTTTCGGAAGAAGATTGAAAAGTTGGCCAGAGACATCCTGATCGACCCTATTCGAGTGGTGCAGGGAGATATTGGAGAGGCAAATGAAGATGTGACACAGATTGTGGAGATTCTCCATTCTGGACCTAGTAAATGGAACTGGCTTACCCGGCGTCTGGTAGAATTTACCTCTTCAGGGAGTGTCCTCCTCTTTGTTACTAAAAAAGCCAATGCTGAAGAGCTAGCGAATAACCTTAAACAGGAGGGTCATAATCTTGGGCTGCTCCATGGGGATATGGATCAGAGTGAGAGAAACAAGGTCATTTCAGACTTTAAGAAAAAGGACATCCCAGTCCTGGTGGCCACAGATGTTGCAGCCCGTGGTCTGGACATTCCTTCAATTAAGACTGTCATTAACTATGATGTGGCACGAGACATTGATACCCACACGCATAGGATTGGCCGCACAGGAAGAGCGGGTGAGAAAGGTGTGGCCTATACCCTACTCACTCCCAAGGACAGCAATTTTGCTGGTGACCTGGTCCGGAACTTGGAAGGAGCCAATCAACACGTTTCTAAGGAACTCCTAGATCTGGCAATGCAGAATGCCTGGTTTCGGAAATCTCGATTCAAAGGAGGGAAAGGAAAAAAGCTGAACATTGGTGGAGGAGGCCTAGGCTACAGGGAGCGGCCTGGCCTGGGCTCTGAGAACATGGATCGAGGAAATAACAATGTAATGAGCAATTATGAGGCCTACAAGCCTTCCACAGGAGCTATGGGAGATCGACTAACGGCAATGAAAGCAGCTTTCCAGTCACAGTACAAGAGTCACTTTGTTGCAGCCAGTTTAAGTAATCAGAAGGCTGGAAGTTCTGCTGCTGGGGCAAGTGGGTGGACTAGTGCAGGGAGCTTGAATTCTGTTCCAACTAACTCAGCACAACAGGGCCATAACAGTCCTGACAGCCCCGTCACCAGTGCCGCCAAGGGCATCCCAGGCTTTGGCAATACTGGCAACATCAGTGGTGCCCCTGTGACCTACCCGTCTGCCGGAGCCCAAGGAGTCAACAACACAGCTTCAGGGAATAACAGCCGAGAAGGGACTGGGGGCAGCAACGGGAAAAGAGAGAGATATACTGAGAACCGGGGCAGCAGCCGTCACAGTCACGGAGAGACTGGCAATCGGCATAGCGATAGTCCACGTCACGGAGATGGTGGTCGCCATGGAGATGGATACCGCCATCCAGAAAGCAGCAGCCGTCATACTGATGGCCATCGGCACGGGGAGAACAGACATGGAGGAAGCGCAGGCCGGCATGGGGAGAACCGGGGTGCAAATGATGGTCGGAATGGGGAAAGCAGGAAAGAAGCTTTTAATCGTGAGAGCAAGATGGAGCCCAAGATGGAACCCAAAGTGGACAGCAGCAAGATGGACAAGGTGGACAGCAAGACAGATAAGACAGCTGACGGCTTTGCTGTCCCAGAGCCGCCTAAACGCAAGAAAAGTCGATGGGACAGTTAGAGGGGATGTGCTAAAGCGTGAAATCAGTTGTCCTTAATTTTTAGAAAGATTTTGGTAACTAGGTGTCTCAGGGCTGGGTTGGGGTCCAAAGTGTAAGGACCCCCTGCCCTTAGTGGAGAGCTGGAGCTTGGAGACATTACCCCTTCATCAGAAGGAATTTTCGGATGTTTTCTTGGGAAGCTGTTTTGGTCCTTGGAAGCAGTGAGAGCTGGGAAGCTTCTTTTGGCTCTAGGTGAGTTGTCATGTGGGTAAGTTGAGGTTATCTTGGGATAAAGGGTCTTCTAGGGCACAAAACTCACTCTAGGTTTATATTGTATGTAGCTTATATTTTTTACTAAGGTGTCACCTTATAAGCATCTATAAATTGACTTCTTTTTCTTAGTTGTATGGCCAGGCAGTCCCCATTTTAGGAGTTGGCTTCTGCAAATTCAATCCATTGAGCTAACTGTTGGGGAGCAATTTGGTAGTTGTAGACATTTGCAGGGAAGGGAGATGTCTGATTCTAAATGGGAGTTGATGCTCAGGTCCCCAGCCAGGTTTGCATCCAGCCCTGAGACATGTAGGAAACACCTTTCAGACCCAGGCTCTGAAGATTCCCAGAAGCCACAAGGATTGAAGGGAAAAGGTGATCCTGGTAACTGTTCCAGGATTGCTCCAGGTTTGAGATGGTATTGCTAAATTTAAAATTAAACAAGAAACCCAACAACAGCTTTTAAAGTGTCTTCTATCTCATTGTATTTTTTTTAACTTGCCCCAATGATAGAAAAGTCTTTTGCTGAAATGATTTTGATGATTTTTGTTTATCGTTTATAAAAAGGAAAAGAAATATACAAACTTTGACTTTTGTGACTTTGTGAAGGTTTCTTTAAGATGTGCATTCCTTTCTGCTTGCTCTCTAGTAAATGTTTTACTACCGGGACCTGTGGATCGTTTGTCATTTCTGTCTATGAATTGGTA