Transcript asmbl_8343

Sequence
Transcript Sequence for observation asmbl_8343 of TGE0007832:
CCCAGGAGATGTATCTGCTTGCTGTAGTCTCAGAGACCAACCGGCTCGCCGCGACACCCAGCCTCTAGCCACCTTTGGCACATCTTAATAGATAGTAAACTATCTTTTTGAGGGCGAATCTTAATCTCCTTGGAAACGCTAAAGACGGCGTCTTCCGGGAAGCCTCGCCCCGTGACCTCAGACGTACACTTCCAGGGCACGAACGTGACCCGTCGCCCCGCCCTTTCCCACTCTCTCTTTCCGGTGGCGGAGTCTGGAGAAGGCACGCAGAAATGGCACCTCGCAAGGGGAAGGAAAAGAAGGAAGAACAAGTCATCAGCCTTGGACCTCAGGTGGCTGAAGGAGAAAATGTATTTGGTGTCTGCCACATCTTCGCATCCTTCAATGACACTTTTGTCCATGTCACCGATCTTTCTGGCAAGGAAACCATCTGCCGTGTGACTGGTGGGATGAAGGTAAAGGCTGACCGAGATGAGTCCGCTCCATATGCTGCCATGTTGGCTTCCCAGGATGTGGCCCAGAGGTGCAAGGAGCTGGGCATCACTGCCCTCCACATCAAACTCCGGGCCACAGGAGGAAATAGGACCAAGACCCCCGGACCAGGGGCCCAGTCAGCTCTTAGAGCCCTCGCCCGCTCAGGGATGAAGATTGGACGGATTGAGGATGTCACCCCCATCCCCTCTGACAGCACCCGCAGGAAAGGGGGTCGCCGTGGTCGCCGTCTGTGAACAGGACTCCTCAAATTGTTTTCTGTTAATAAATTGCCTTTGTGTGAGCTCTTTC