Transcript asmbl_8885

Sequence
Transcript Sequence for observation asmbl_8885 of TGE0020563:
GGCCGGTGGACGCGTCGGAATTTTGGCGTCACACAGGTTTAAAGATCGCAGGCACTTTTCTCCTTTGTTCCGGCGTCAGTGTTCTTTGGATGTCAACATCTCTAGGCTTCGGTCGATTTCACCAGGGCTCACGAGTGTCTTAAATGGGCTCTGAAAGGGAGAATTTTGCACACTCGGACACGCCAGTTTGGACTCTTGCGCATGTGCAGTGACCCCAAGGCGCCGAGGGCAAGCCCAGAGCCTAGTCCCGCCGGTGTAGTGCTCTCCCGGAGCCGTGTGCCTGCGTGGCGTCTTCAGAATGTCCGCCCCGTTTGAGGAGCGCAGCGGGGTGGTTCCTTGCGGGACTCCGTGGGGACAGTGGTACCAGACCCTGGAGGAGGTGTTCATTGAAGTCCAGGTGCCCCCCGGCACTCGCGCGCAGGACATCCAGTGCGGCCTGCAGAGTCGGCACGTGGCTCTGGCCGTGGGTGGCCGCGAGATCCTCAAGGGGAAACTGTTTGATTCTACAATTGCTGATGAAGGAACATGGACTTTGGAGTCTGAATATGCAGCTGACCCCTGGGTGCAAGACCAAATGCAGAGAAAACTTACATTAGAGCGATTCCAGAAAGAAAATCCTGGTTTTGACTTTAGTGGAGCAGAAATCTCAGGGAACTACACGAAGGGCGGACCAGATTTCTCAAACCTTGAGAAATGACTGCTATTGCTTAGTGTTTCTCTGTCTCGTGGATCCCGGCAGGTGCTGGCAACTTAATGCAGTTGATGAGGAGAAGGATGGAGCAGCCAGTGTCTACAGTTAAAGATTGCCAAGTGTATTTCAATATGGTTGTAAAGATCACATTCAGATATGGTTTGCACAGGAGGCAGAGCAGCTCTAATGTGGATAGATGATAACTTTTACTGCTCTGCAGTAAGTTTTATAGGCTACATTTTCCTAATTTCATATTTAATTGTATTTTTACTACAAAAAACATTGGAGTACAAATCATATGAAATGAAAAAGGTGCCTTCATGGAAAAATATTTTTTTTGTATGTGTGTGATATAAAAATAATGTTGAGTAAATTTCTGAGTAAGAGTTGTATACCCTTTGTCTAAATATGCTTGTCTGTTCACGGAAAGGACAGAACTGGAAATTTTAAGAAAGGAAAAAAAGTACACTGAAGTACTTTGGATAACTTGAGTTAATGAAAAGTTCTAACTGGTTTGGTGCTGCCTAAGTGATTATGTCAAGAAATTGAAAAATGATAAACCCCTAACAACGGAAGAGTTAATTGCCTCTTAATGTCAGACAACAGTTGAGGCCCCTGAGTATAAGTCAGTGGCTTCATTTCATTTTAAACATTCAGACAAGGTGGTCTAGAAAAAAAGTCTTGCATCCTCTGTGTTTTTTAATTCTT