Transcript asmbl_8806

Sequence
Transcript Sequence for observation asmbl_8806 of TGE0001383:
AGTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATCACTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGTCGGAGTGGGGTCGACGTTTGCTCTACCGGAACAGCTTAGCTCATTCCTCCCTTTCCATTACCTGTGGCGCGGAGAGTTGGGGCGGCGGCTGCGTCAGCAAGGGCGGTGGTGGCGGCGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGATTCTGGGGTTGGAAAGTCCTGCCTTCTCCTTAGGTTTGCAGATGATACGTATACGGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAGATACGAACTATAGAGTTAGATGGGAAAACAATCAAGCTACAGATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACTTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAACGTTAAACAGTGGCTGCAGGAGATAGATCGCTACGCCAGTGAAAATGTCAACAAGTTGTTGGTAGGGAACAAATGTGACCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCAGATTCCCTTGGAATTCCATTTTTGGAAACCAGTGCTAAGAACGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCTACAGCTGGTGGTGCCGAGAAGTCCAATGTTAAAATCCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGCTGCTGCTAAAATCTGCCTCCGTCCTTTTCTCACAGCAATGAATTCGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTTTCCACAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTTATTCCCTTGACTCAAGACCGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGATCGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTATATTGGCATGTTTAGATGTTGGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCACACAGCACAACCAGTGTCTGTCAGTTTCCACGCATAAAGTTTAGTGAGACGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTGGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACTGTATGGTGATAAGTATTGTTTTAATTCCTATGATTAAAGGGAAATAGAGCTTTGCATTCTACTCAGCAGCCACGTGTGTGCAGCAAGGGCACTGTAGACCTATCTTAATAGCACAGCATCCAGGGTTTGCTTTCTAGTAATAGGTCTGATGAGTGACCTAGAGAAGCTTTTGTGCTGTGTAGAGACTTCACCACCTTCATTGGTTCAAGGAACTCAAACTCTAGTGCTTCATCTCCAGCCCAGGCCACCTGAAGTGGCTTCACCAGCAACCCTTTTTTCCCTCATCTGTGGTAGAGATGGAGAGCAGCCCATGCTTCCTCCCAGGCAGTGATCTGGTAATAGTGCTGGTGTTTCTTCATGCTCAGTCTGATGGCGCACACACCTTTTTCTTTCTTTTTTCTTTTTGGCTATTGGAGATAGGGTTTCTCTGTGTATCCCTGGC