Transcript asmbl_835

Sequence
Transcript Sequence for observation asmbl_835 of TGE0003178:
CTTCGCCGCGCCGCTGCCGCTCTCCAACGCCAGCGCCGCCTCTCGCTTGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTGTCCTTACCATGGCTCGTACAAAGCAGACTGCCCGCAAATCCACCGGTGGTAAAGCACCCAGGAAACAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCCCTCCGTGAAATCAGACGCTATCAGAAGTCCACTGAACTTCTGATCCGCAAGCTCCCCTTTCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTCAAAACAGATCTGCGCTTCCAGAGTGCAGCTATTGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGATACCAATCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGATATCCAGCTAGCACGCCGCATACGCGGAGAACGTGCTTAAGAGTCCACTATGAGGGGAAACATTTCATTCTCAAAAAAATTTTTTTTCCTCTTCTTCCTGTTATCAGTAGTTCTGAATGTTAGATATTTTTTCCATGGGGTCAAAGGTACCTAAGTATATGATTGCGAGTGGAAACATAGGGGACAGAATCAGGTATTGGCGTTTCTCCACGTTCATTTGTGTGTGAATTTTTAATATAAATGCAAGATGGAAAGCATTAATGCAAGCAAAATGTTTCAGTGAACACATTTCAACAGTTCAACTTTATAACAATTATAAATAAACCTGTTAAAATTTTCTGGACAATGCCAGCATTTGGATTTTTTTAAAATAAGTAAATTTCTTATTGACGGCAACTAAATGGTGTTTGTAGCATTTTTATCACACAGTAGATTCCATCCATTCACTATACTTTTCTAACTGAGTTGTCCTACATACAAGTACATGTTTTTAATGTTGTCAGTCTTCTGTGCTGTTCCTGTAAGTTTGCTATTAAAATACATTAAACTATA