Transcript asmbl_56182

Sequence
Transcript Sequence for observation asmbl_56182 of TGE0003118:
GCTCCAGCGCGCGCGCAGCCTCCGACCCTAATTTCTTCGTTCGCCGGAAGAAGGCGAGTCTCTTTCCGTTCCTAGCGCAGCCATGGCTCGTGGTCCCAAGAAACACCTGAAGCGTGTAGCTGCTCCAAAACATTGGATGCTGGATAAGTTGACTGGCGTGTTTGCTCCTCGTCCATCCACTGGTCCTCACAAGCTGAGGGAATGCCTGCCTCTCATCATTTTCCTAAGGAACAGACTTAAGTATGCCCTGACTGGAGATGAAGTAAAAAAGATTTGCATGCAGCGATTCATTAAGATTGATGGGAAAGTCAGGACCGATATAACCTACCCTGCTGGGTTTATGGATGTCATCAGCATTGACAAGACCGGAGAGAACTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCATCGTATTACACCGGAGGAGGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTAGGCACAAAAGGAATCCCGCACCTGGTGACCCATGATGCTCGTACTATTCGGTACCCTGATCCCCTCATCAAGGTGAACGACACCATTCAGATTGATTTGGAGACAGGCAAAATAACTGACTTCATCAAGTTTGACACTGGGAACCTGTGTATGGTGACTGGAGGTGCTAACTTGGGAAGAATTGGTGTAATCACCAACAGAGAGAGACATCCCGGCTCTTTTGATGTGGTTCATGTGAAAGATGCCAATGGCAACAGCTTTGCCACTCGGCTGTCCAACATTTTTGTTATTGGCAAGGGTAACAAACCATGGATCTCTCTTCCCAGAGGAAAAGGAATCCGCCTCACCATTGCTGAAGAGAGAGACAAGAGGCTTGCGGCCAAACAGAGCAGTGGGTGAAATGGTCTCTAGGAGACATGCTGGAAAAGTGTTTGTACAAGCCTTTCTAGGCAACATACATGCTAGATTAAACAGCATGGTGAAACT