Transcript asmbl_55845

Sequence
Transcript Sequence for observation asmbl_55845 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGCGACGACTTACTCCCGGCAGGGACTGAGGACTACATTCATATAAGGATCCAGCAGCGCAACGGCAGGAAGACGCTGACCACTGTGCAGGGCATTGCGGACGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGCAATGGAACTGTGATTGAACACCCTGAGTACGGAGAGGTTATTCAGCTTCAAGGGGACCAAAGGAAGAACATCTGCCAGTTTCTTCTGGAGGTTGGCATCGTCAAGGAGGAGCAGCTGAAGGTTCACGGGTTCTAAGATGAACCCAAGCGTGGCGAGTTTCTTAAATGGTTTTGTTCTCTAACTCAGTTTGGCTGCCTCGGGAGATGATTCTTTACAGTAAACGACAGACTTTGCGTTTATTTAATCATTCAGACTTCCACTCACACCTGCATGGCTACAGAAAACACGGGGTATGTAGGCTCCTGAGTCATAAGGAAATCGCGGTGAGATGGGAACGAAGCCCG