Transcript asmbl_4848

Sequence
Transcript Sequence for observation asmbl_4848 of TGE0001085:
CGATAACTGCGCAAGCGCAGCCCGTACTTCCTTTTCCGAGTAACCGCCAAGATGGCCGAAGTGGAGCAGAAGAAGAAGCGCACCTTCCGCAAGTTCACCTACCGTGGCGTAGACCTCGACCAACTGCTCGACATGTCCTATGAGCAACTGATGCAGCTGTACAGCGCCCGCCAGAGGAGGCGCCTGAACCGTGGTCTTCGGCGGAAGCAACACTCACTGCTCAAGCGCTTGAGAAAGGCCAAAAAGGAGGCACCACCCATGGAGAAGCCTGAGGTGGTGAAGACGCACCTGAGGGACATGATCATCCTGCCGGAGATGGTGGGTAGCATGGTGGGCGTGTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAACCAGAGATGATCGGCCACTACCTGGGCGAGTTCTCCATCACCTACAAACCCGTGAAGCACGGCCGGCCCGGGATCGGTGCCACCCACTCCTCCCGATTCATCCCCCTCAAGTAGCCGAGGCCAATAAAGACTGGTTTTGGTCCCTGG