Transcript asmbl_47088

Sequence
Transcript Sequence for observation asmbl_47088 of TGE0001056:
GCCAAAGGCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGAAACCTACACCATGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGGAATTCAACACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCGAGAAATAAAACCCTGTGCTTTTTGGTT