Transcript asmbl_47003

Sequence
Transcript Sequence for observation asmbl_47003 of TGE0038201:
AGTGAAATATTGTGGGGCTGAGATCCCTCGTAGCAACAAAAAGTTTGCTACCATCGTTGAAGGAGGCTATGATGGACTTCTTCAACGCCCAGATGCGCTTGGGAGGGTTGACTCAGGCCCCTGGCAACCCAGTCTTGGCTGTGCAGATAAATCAAGACAAGAATTTTGCCTTTTTGGAGTTCCGGTCAGTGGATGAGACGACCCAGGCCATGGCATTTGATGGCATCATCTTCCAGGGCCAGTCATTGAAGATTCGAAGGCCTCATGACTATCAGCCATTGCCTGGCATGTCAGAGAACCCCTCTGTTTATGTGCCTGGAGTTGTATCCACTGTAGTCCCAGATTCTGCCCACAAGCTGTTCATCGGGGGTTTGCCCAATTACCTAAATGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTTAAGGATAGTGCCACAGGGCTCTCCAAGGGCTATGCCTTCTGTGAGTACGTGGACATCAACGTCACAGATCAGGCCATTGCGGGGCTGAATGGGATGCAGCTAGGGGACAAGAAGCTGCTTGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAATCAGACACCTGTGACCCTTCAAGTGCCCGGCCTGATGAGCTCTCAGGTGCAGATGGGCGGTCACCCAACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGATGAGGAGTATGAGGAGATTGTAGAGGACGTACGAGACGAGTGCAGCAAGTATGGGTTGGTCAAATCCATTGAAATTCCCCGCCCCGTGGACGGCGTCGAGGTGCCTGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGTCTAACCGGTCGCAAGTTCGCCAACAGAGTGGTGGTCACAAAATACTGTGACCCTGATTCTTACCACCGTCGGGACTTCTGGTAGAGGTGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGACTTTCCCCCCACCTGTCCCCTCCTCCTTTCCCCCCTCTTGAAGAAGATGGGCAGAGGAGTGACAGCCGAATGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGGGGTGGGGGGTGGGGGGCTAGGGCAGGAAGGGGACTGGGCAAGTGCACACAGGCCCACACAGACACATGCACCCACACAGACACAGAGGGAACGGGCTGGGATGGGGACTGTGTGCACAGCAGGGCGGGTAGGACCTCCACAGCCCCTTCCCAAACAGCCTCTTATCCCTTACACCCCTTTCCTCCTCTCTTCCCCCATGGTAGGAACATAGCGTGTTTATATTTTATGGCCAAACTATTTTGAATTTTGTTGTCTGGCCCTCAGTGCCCTGCCCTCTCCCTTTGCAGGACCACAGCTCCCGTCCTTTGGCTTCTGGTCCTTCCTGTTCTCCACCCTGGTTTCTTAAGTAGTTGGTTCTTCTCCTTAGTCTTCCTGACTCAACCCGTGGTCTCTGTCCCGCTCCCCCTCTCTGTGGCAGTTTCATATTTGCTAATACGAATTTGCTCATTAAACATTTTGTTGTATTTTA