Transcript asmbl_74889

Sequence
Transcript Sequence for observation asmbl_74889 of TGE0007724:
TGGCTGTGGGTCCAGGAATAGCCTTGGAACCAAAATGGGACATGAGTTGAAGACAATCTAATCTCTGCCCTGAATCTGTTCTAGAGTGGACAATACATGGATTTAGATGCTGTTACAAAACACTCAGCATTACATGCAAAGCCCAATGGACTCATTCTTCAATATGGGACTGCTGGATTTCGAATGAAAGCAGAACATCTTGATCATGTCATGTTTCGCATGGGATTGTTAGCTGTCCTGAGGTCAAAATATACAAAATCTACAATAGGAGTCATGGTAACAGCATCACACAATCCTGAGGAAGACAATGGTGTCAAATTGGTTGATCCTTTGGGTGAAATGTTGGCACCTTCCTGGGAGGAACATGCTACCTGTTTGGCAAATGCTGAGGAAGAAGATATGCAGAGTGTGTTGATGGACATCAGCGAGAAAGCAGCGGTAGATCTGCAACAAGATGCCTTCGTAGTGATTGGTAGAGATACCAGGCCCAGCAGTCAGAAACTTTCACAGTCTGTAATAGATGGTGTCACTGTTTTGGGAGGTCAGTTCCATGATTATGGCTTGTTAACAACACCCCAGCTGCACTACATGGTATACTGTCGAAATACGAATGGGCAATATGGAAAGGCAACCATAGAAGGTTACTACCAGAAGCTCTCTAAGGCTTTTGTGGAACTTACCAAACAGGCTTTCTGCAGTGGAGATGAATATCGATCACTTAAGGTTGACTGTGCAAATGGCATAGGGGCCTTGAAGCTAAGAGAAATGGAATACTACTTCTCCCAGGAGCTGTCAGTTCAGCTGTATAATGATGGGACCAAAGGGAAACTCAATCATTTATGTGGGGCTGACTTTGTGAAAAGTCATCAGAAACCTCCACAAGGAATGGAAATGAAGTCCAATGAAAGATGTTGTTCCTTTGATGGAGATGCAGACAGAATTGTTTATTATTATCATGATGCAGATGGCCACTTTCATCTCATAGATGGTGACAAGATAGCAACTCTCATTAGCAGTTTCCTTAAAGAGCTCCTATTGGAGATTGGGGAAAGTTTGAATATTGGTGTTGTACAAACTGCATATGCAAATGGAAGTTCAACACGCTATCTTAAAGAAGTTATGAAGGTACCTGTCTATTGTACTAAAACTGGTGTAAAACATTTGCACCACAAGGCTCAAGAGTTTGATATTGGAGTTTATTTCGAAGCAAATGGTCATGGCACAGTACTGTTTAGTAAAGCTGCTGAAATGAAGATAAGAGAACTAGCAAAAGAATTAGAAGATAAGAAAAGGAAAGCTGCTAAGATGCTTGAAAACGTTATTGACTTGTTTAACCAGGCAGCTGGTGATGCTATTTCTGACATGCTGGTGATTGAGGCAATCTTGGCTCTGAAAGGCTTGACTGTACAACAGTGGGATGCTCTCTATACGGATCTTCCAAACAGACAGCTCAAAGTTAAGGTTGCAGACAGGCAACTTATTAGCACCACTGATGCTGAAAGGCAAGCAGTTACACCCCCAGGACTACAGGAGGCAATCAATGACCTGGTGAAGAAGTACGAGCTTTCCCGAGCTTTTGTCCGGCCATCTGGTACAGAAGACATAGTCCGAGTATATGCAGAAGCAGACTCACAAGAAAGTGCGGATAGCCTTGCATATGAAGTGAGCGTGGCAGTATTTCAGCTGGCTGGAGGAGTTGGAGAAAGTCCCCAACCAGGTTTCTGAAGACAGTTTTTATATTTATGAGAAACTGGATTTTTAAAAAGTTTTTACAAAATACTGCCATTATTGTGACAGTTCCAAACACATTTATAATCATAACGTTTACAGTGCACCTTACTGGATTGTTTCTAGATGATTGCTTTTCTTAAACACTACCAGAATAATACTTTAGAGATAGCTAAGCCTTATACTTGTTAAATTCAGTTTAAAAATGAAACCTACTTCTAGTTTCACCAATGTAAACTATTGGAGCTTATGTACATGATTCAGTCATTAATTTTTTAATATATGCTGGGAAAAAATCTTATTACCAACGTGTTGGGATGTCTTTTTCATTGCTGTTACCTAACCAGGAAACTGTTTTTGCAGTATTCATCACTGTGGACACAAATGGGA