Transcript asmbl_46625

Sequence
Transcript Sequence for observation asmbl_46625 of TGE0000661:
GCTTCCCATAATTCCGTGCGTTTGCCCGGCCCACTCTCTTTCTGCCATCTTCCCTCGCCGCCACCATGGTGCGAATGAATGTTCTGGCGGATGCTCTCAAGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAACCGTGATGATGAAGCACGGATACATTGGTGAATTTGAGATCATTGATGATCACAGAGCTGGGAAGATTGTTGTGAACCTCACAGGAAGGTTGAACAAGTGTGGCGTTATAAGCCCTAGATTTGATGTTCAACTCAAAGACCTAGAGAAATGGCAGAACAACCTGCTCCCTTCACGTCAGTTTGGCTTCATTGTGCTGACAACCTCGGCTGGCATTATGGACCATGAAGAGGCAAGACGAAAACATACAGGAGGGAAAATCCTGGGATTCTTTTTTTAAACGTAAAGCATAAATAAAAAGCCTTTGTGGACTGTG