Transcript asmbl_43992

Sequence
Transcript Sequence for observation asmbl_43992 of TGE0034453:
CCGGACGCAGCTAGGCTGTACAGACGCGGGCACGCACACCAGCACGCACGCCCTCCTCTCGTGCGGCCGCGGTCGTTCCCGCGTCCACCAGCAGCGCTGTCGCTTCGGCAGAAATGCTGCGGGCCTGTCAGTTATCCGGCGTGACCGTCGCGGCCCAGAGTTGTCTGTGTGGGAAGTTCGTCCTCCGTCCACTACGACCATGCCGTAGATACTCCACTTCAAGCAGTTCTGGGTTGACTGCTGGTAAGATTGCTGGAGCTGGCCTTTTGTTCGTTGGTGGAGGGATTGGTGGCACTATCCTGTATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATCCCTTACTCAGACAAACTCTTTGGGATGGTTCTTGGTTCTGCGCCTTATACTGTTCCATTACCAAAGAAACCGGTTCAGTCTGGTCCACTAAAAATCTCCAGTGTATCAGAGGTGATGAAAGACTCCAAACTGCCTGTGGCACAGAGCCAGAAAACGAAGGGAGACACTCCAGCTTCAGCAGCAGGTGATACACTTTCGGTCCCGGCCCCTGCAGTTCAGCATGAGGACACTATAAAAACCGAATGTCCCAACACTAATGAAGGAAAATCTACGTCTGAAACCACAGCTCTAGCCAAGAGTTTAGAAGATGCTCTGAACCGGACTTCGTCTGTCACTCTGCAGACTATTACAGCCCAGAATGCTGCAGTTCAGGCTGTCAAGGCACACTCCAACATACTGAAAACAGCCATGGACAATTCTGAGATTGCAGGTGAGAAGAAGTCGGCCCAGTGGCGAACAGTGGAGGGTGCATTGAAGGAGCGAAGAAAGGCAGTTGATGAAGCTGCCGATGCCCTGCTCAAAGCAAAAGAAGAGTTAGAGAAGATGAAAACTATAATTGAAGATGCAAAGAAAAGAGAGATTGCTGGAGCCACCCCTCATATAACTGCTGCAGAGGGGAGACTTCACAACATGATAGTTGATCTGGATAACGTCGTCAAAAAGGTCCAGGCTGCTCAGTCAGAGGCAAAGGTGGTATCTCAGTATCATGAACTTGTGGTCCAAGCAAGAGATGACTTTAGAAAAGAGCTGGACAGTATCACTCCAGACATCACTCCTGGATGGAAAGGGATGAGTAAGTACAACTGATTCTGGCAAACTCTCTACTGATGACCTGAACTCACTCATTGCTCATGCCCATCGTCGCATTGATCAGCTCAACAGAGAGCTAGCACAACAGAAAGCCACAGAGAAGCAGCACATTGAGCTAGCCTTGGAAAAGCACAAGCTAGAAGAAAAGCGGACCTTTGACTCTGCAGTGGCAAAAGCATTGGAGCACCACAGAAGTGAAATTCAGGCTGAGCAGGACAGAAAGGTAGAAGAAGTCAGAGATGCCATGGAGAATGAAATGCGGACCCAACTTCGACGGCAGGCAGCTGCCCACACTGATCATTTACGAGATGTCCTCAAGGTGCAGGAACAGGAACTGAAGTATGAATTTGAACAGGGCCTGTCTGAGAAACTGTCTGAGCAAGAATTAGAGTTTCGTCGTCGCAGTCAAGAACAAATGGACAGCTTTACTCTGGACATAAATACTGCCTATGCCAGGTTGAGAGGGATTGAGCAGGCTGTTCAGAGTCATGCAGTTGCTGAAGAAGAAGCCAGAAAAGCCCACCAGCTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAATGCCTACCATCCCATTGGGGAGTGCAGTTGAGGCCATCAGAGTCAACTGTTCTGATAATGAATTTACCCAGGCTTTAACTGCAGCCATTCCTCCAGAGTCCCTGACCCGGGGGGTATACAGTGAAGAGACCCTAAGAGCCCGTTTCTATGCTGTTCAAAAACTAGCCCGAAGGGTAGCGATGATTGACGAAACCAGAAATAGCCTGTACCAATACTTCCTTTCCTACTTACAGTCCCTACTCCTGTTCCCGCCTAAGCAACTGAAGCCCCCGGCGGAGCTCTACCCTGAAGATATAAATACATTTAAATTGCTCTCATATGCCTCCTATTGTATTGAGCATGGTGACCTGGAGCTGGCAGCAAAGTTTGTCAATCAGCTCAAAGGGGAGTCCAGAAGAGTGGCACAGGACTGGCTGAAGGAGGCCCGAATGACCCTAGAAACTAAGCAGATAGTGGAGATCCTGACTGCATACGCCAGCGCCGTAGGAATAGGAACCACTCAAGTGCAGCAAGAGTAAGGCCTAGGAAGAGTTGTGTAATGTCATATTTCATATCAAAGAAAATCAGCATTGGTATCTGCAGGGTTTGCAACAAGGGTCCCAGAATTGTCCAGAAGTGAGCAGGTTCCAAGTCCTGTGTGAGATGTTAACACCTGTTGCATTTACCGTCCTTACACTGCTATCATGCCAATGAACTCCAGGAGGCTTTATTTGCAACTTGTGTAACACTTCCTGTTTTTTAGGTTTTACTGATCAGGCTTGTGAGCCACTCAAAATAATGTTTGTGATCCCTACTATTGATTCTGCCCTTGGAGCAAACTGAATAAAGCAACACAATGAAAACTGA