Transcript asmbl_43394

Sequence
Transcript Sequence for observation asmbl_43394 of TGE0001765:
TGTGGGCAGCTCAGACGCCGAAGACCTAAAAACATATAGTGAATAAGGCACTGCTGGAGTGATTGTTAGGTGAATGCATTTCCAGAGAGATTTTGCCTCCCTCTACTCCCTCCTGACACTCTAACTGCAGCTATGAGCAGCAACGAATGCTTCAAGTGTGGACGATCTGGCCACTGGGCCAGGGAGTGCCCTACTGGTGGAGGTCGGGGTCGTGGAATGAGAAGCCGCGGCAGAGGTGGTTTTACCTCGGATAGAGGGTTCCAGTTTGTTTCCTCGTCTCTCCCTGACATCTGCTACCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTGCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTACAATTGTGGCAAGCCAGGCCATCTGGCTCGTGACTGTGACCACGCGGATGAGCAGAAGTGCTATTCTTGTGGTGAATTTGGACATATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAATTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCATCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGGCTGTTCCCAGGCCAGTGAGCTTTACTTGCAGTGTAAAAGGAGGAAAGGGGTGGAAAAAACCGAATTTCTGCATTTAACTACAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGTGCCACTGGTGAATAGGGATTAATGAATGGGAAGAGTTCAGTCAGACCAGTAAGCCCTTCTGGGTTTGAGTGTGTTCCCATGTAGGAGGTAAAACCAATTCTGGAAGCATCTAAGCTTCCATAAATAACTTTAATTCTTAGCATAATGACGGCCTTGGATTGTCTGACCTCAGTAGCTATTAAATAACATCGAGTAACATCTGCATCAGGCCCTCAGAATATACAGTTGAGTTGGGAGTAAACTGAAAAGACAAATGTGTTGAAGGCTATGCCAGGGAATCTGGCTCAAAGCCTAACACAGAAGCAGCTTCATCCCAGTGACGATGCTGGACGTACAGATGGTGATGGCAAAGGTGTAGAACACATTTTTTCAAAGACTAAATCTAAAACCCAGAGTAAACATCCGATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAATGCATTTTCACAGAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTGTTTCATTTGCTGTAATCAGTTTTTAAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAAATGTAATTTTAAACTATTCCAATAAAGCTGGAGGAGGAAGGGGAGTTTTGACTAAAGTTCCTTTTGTTTGTTTTAAATTTTCATCAATGTATATAGAACAAAATACCATATTAAAGAGGGGAATGTGGAGGACTGAAAGATGACAGTTTGGACTTTTCTTTCTATGCTAAGTAATGTCTTCAGTAAGGAAAAGCTGGT