Transcript asmbl_43393

Sequence
Transcript Sequence for observation asmbl_43393 of TGE0001765:
AAGAGATGTGCAGTTTGTAAAATGTTTTAAGCCAAGTCAGCTGAAGACCAAGGGCTTATATTCTGGCAGTTGAACAACTGCAAATGTTAAGATTTTGTAATGATGTATGGCTTTTTACCTTTTAGACCTAAAAACATATAGTGAATAAGGCACTGCTGGAGTGATTGTTAGGTGAATGCATTTCCAGAGAGATTTTGCCTCCCTCTACTCCCTCCTGACACTCTAACTGCAGCTATGAGCAGCAACGAATGCTTCAAGTGTGGACGATCTGGCCACTGGGCCAGGGAGTGCCCTACTGGTGGAGGTCGGGGTCGTGGAATGAGAAGCCGCGGCAGAGGTGGTTTTACCTCGGATAGAGGGTTCCAGTTTGTTTCCTCGTCTCTCCCTGACATCTGCTACCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTGCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTACAATTGTGGCAAGCCAGGCCATCTGGCTCGTGACTGTGACCACGCGGATGAGCAGAAGTGCTATTCTTGTGGTGAATTTGGACATATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAATTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCATCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGGCTGTTCCCAGGCCAGTGAGCTTTACTTGCAGTGTAAAAGGAGGAAAGGGGTGGAAAAAACCGAATTTCTGCATTTAACTACAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGTGCCACTGGTGAATAGGGATTAATGAATGGGAAGAGTTCAGTCAGACCAGTAAGCCCTTCTGGGTTTGAGTGTGTTCCCATGTAGGAGGTAAAACCAATTCTGGAAGCATCTAAGCTTCCATAAATAACTTTAATTCTTAGCATAATGACGGCCTTGGATTGTCTGACCTCAGTAGCTATTAAATAACATCGAGTAACATCTGCATCAGGCCCTCAGAATATACAGTTGAGTTGGGAGTAAACTGAAAAGACAAATGTGTTGAAGGCTATGCCAGGGAATCTGGCTCAAAGCCTAACACAGAAGCAGCTTCATCCCAGTGACGATGCTGGACGTACAGATGGTGATGGCAAAGGTGTAGAACACATTTTTTCAAAGACTAAATCTAAAACCCAGAGTAAACATCCGATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAATGCATTTTCACAGAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTGTTTCATTTGCTGTAATCAGTTTTTAAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAAATGTAATTTTAAACTATTCCAATAAAGCTGGAGGAGGAAGGGGAGTTTTGACTAAAGTTCCTTTTGTTTGTTTTAAATTTTCATCAATGTATATAGAACAAAATACCATATTAAAGAGGGGAATGTGGAGGACTGAAAGATGACAGTTTGGACTTTTCTTTCTATGCTAAGTAATGTCTTCAGTAAGGAAAAGCTGGT