Transcript asmbl_74397

Sequence
Transcript Sequence for observation asmbl_74397 of TGE0007664:
CCCAACCCCCCCGCCCCCCACCCCGTAAACTCTCCCAGTTTAAGTGACATGCACAGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGGTAAGACTTTTTGAAGCTTTCTTGCAGCTTGCTGGGCGTTTTGCTGCTGCCACTGGACAGTTTCAGCTCTTTTCTTTATGTTGTTGCTTCGCGCTGCTGTCCCGCCTAAATTTATCTCGTTACTCTCCTAAGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGAGGAGGCGCGCAGCGCTGATCCCCTCCAGTCTCCTTTCTCAAATCTCCCTGCGGAGGGCTGTCAAGGTTGGCCGCGCGGCAGAAGTCCCTCTGGCCGGCCTAACCCTCCCCTGCCCCCAGAGGGTACAAAAAGACATGAGAAGACGCTTGTAACCTGAAACTTCCCTCTCATCCATCTGGACCTGGAGGAGAGGTCCGGGCGGGGGCGCAGACCCGGAAGGCTGGTCGTCAGCGGAGGCGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGAAACAATTTTGTGAGAGCATTACAAAGTTGGTAAGAGGGAAGAATTCTATATGATAAACAGTTCACAGTTTGGGGCTTTTTCTAGACTAAGTTTTTAGGATAGAACAAAATTATTTACTTAAACTCTCCATATGAAATTGTTCTATAGGTGTTTAGAGTATACAACAAATATGGTGCAAATAAATGTATGAAAATTAAGTGTCTTAAAGGTAGAATATACTAAAAGATTTTAAAATATAAAGTTTTCCTAAGATCATAATACAAATTGAAACAGACTTTCTTGAGAATATTTTTTTTAAAAAAATGGAACATACACAGTGGATAGTTTATCAGAGACCCTGCTAATATGTTTAAAAAATTGTAATGATGGGGTAGGAGTTTGAGGAAATAACCGGAGATAAATGTATGTGTTCATAAACAAGTGTCTCGACTAATCATAGTTTCTTATGTTTAGTTCAGTATTTATAAATATGAGGATATTTTGATTTAGATAAGCTATATGTTGGTATATACACCTTTGTGAGGAATAAAATCCCATTTAGGTTTAAATAAAAGCAATCGGTTAATCAATTGATATTCTCTGAGTTAAATTCAGAAGTGTTCAAAATAGGGCTAAAATCATGATATCTGTTCTTTCTGTAGACTACACAGTCAGAATATGAATTTTAACTATATTAACTTTCATAAGGTTTATTTTATAAAATGTAACATTTGTTATTTATGGTTATACTTCAGATCCTATGAAAAAGTTAAATATATGGTACTTAACATTCCGTTAAACGTTTTAAGTGTTCATCAGGAATTCATAAACTGGCTGCTTGCCATTATTTCCAAAGAATGATAAAGATATGAGCGTGCCAAAAATAGTGAAAACATATAATAAGAGCACACACATGTTAGGAATAAACTGCTGATGGACTTTAGTAAGTCTGCTGATATTGTAGAAAACAAATTGTAATATTTGTAGTCGCTATTCAGAAGAATTATTTTTCCATCATGTGATAATCTAACAGTTAAAAACTGAGCTTTATGCTAGATCCAGGAAAGCAGTAGTTTCATTAGTCTAGCTTTTCTCATCATCAACTCACTGAAGCAGAATCTGATGAAGTGAAGCCAAGTTTTCATCTGTTAGGTGGATGGCTTTTTTTAAGTTATAATTTCTTGCTTCTTTTTCATTCCCTTGCTTCTTTCTCTGTATGAACTTCCGAATATGCCACTGCTCTCTTTTCTATCATATCACTCCTTGCTATTTTCTAGTACATGGCAATAGAACATTCTTAAGGTAAAAAATATTACTGTTTGAAAACAATTGGTATTGTGCAGTCATAATACTCTAAGTCTATAAGCTTATAAGGCATTT