Transcript asmbl_39300

Sequence
Transcript Sequence for observation asmbl_39300 of TGE0017903:
AATTTTCTTCTTAACATTTTAATACTGCTTTTTGTCTTTACAGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACCACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAGTCGGAGAGTGTAGATAAGGTCATGGATCAGAAAGAACATAAATTGAATGGGAAAGTCATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCTGTCAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGACACACCTGAAGAAAAAATAAGAGAGTACTTTGGTGGTTTTGGTGAGGTTGAATCCATAGAGCTCCCTATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGTTTTATTACCTTTAAGGAAGAGGAGCCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGATCTAGAGGAGGGTTTGCAGGCAGAGCTCGCGGAAGAGGTGGAGGCCCCAGTCAAAACTGGAACCAGGGATATAGTAACTATTGGAATCAAGGCTATGGCAACTATGGATATAACAGCCAAGGTTACGGAGGTTATGGAGGATATGACTACACTGGTTACAACAACTACTATGGATATGGTGATTATAGCAATCAGCAGAGTGGTTATGGGAAAGTATCCAGGCGAGGTGGACATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTCTATCAAGTTCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGTATCAATTTGTGTTTTATGCCCCCCCTCCCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTATCATCAGAATAGGAGGAAGTGAAATACTACAAATGTTTGTCTTGGATTCAAG