Transcript asmbl_38979

Sequence
Transcript Sequence for observation asmbl_38979 of TGE0052053:
CTCCTCTGCAACGCCAGGGCCGGGAGTCTTAGAACCGAGGGCCCGCAGGGGTCCCCGCGGCCGCTGCAATGCAGAAATACGAGAAACTGGAGAAGATTGGGGAAGGCACCTATGGAACTGTGTTCAAGGCTAAAAACCGGGAAACTCATGAGATTGTGGCTCTGAAGCGTGTCAGGCTGGATGATGACGATGAGGGTGTGCCAAGTTCAGCCCTCCGGGAGATCTGTCTACTCAAAGAACTGAAGCACAAAAACATTGTCAGGCTTCATGATGTCCTGCATAGTGACAAGAAGCTGACACTGGTTTTTGAGTTCTGTGATCAGGACCTGAAGAAATATTTCGACAGCTGCAATGGTGACCTGGACCCTGAGATTGTGAAGTCATTCCTCTTCCAGCTGCTGAAAGGCCTGGGATTCTGTCACAGCCGCAACGTGCTACATAGGGACCTGAAGCCCCAGAACCTGCTCATAAACAGGAATGGGGAGTTGAAATTGGCTGATTTTGGCCTGGCCCGAGCCTTTGGTATCCCCGTCCGCTGCTACTCTGCTGAGGTGGTCACGCTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCTAATGCAGGACGACCTCTCTTCCCTGGCAATGATGTGGATGACCAGCTGAAGAGGATCTTCCGACTGCTAGGGACACCGACTGAGGAACAATGGCCTGCCATGACCAAGCTGCCAGACTATAAGCCCTACCCAATGTACCCAGCTACAACATCCTTGGTGAACGTCGTGCCCAAGCTCAATGCCACGGGGAGGGACCTGTTGCAGAACCTATTGAAGTGTAACCCTGTGCAGCGCATCT