Transcript asmbl_3844

Sequence
Transcript Sequence for observation asmbl_3844 of TGE0005318:
ATTTATTGTCGCGGGGGAAGCGGCGGCCGCCCTGTACCCGGAACAACAAAGCGAGAAACCGAGCTCGAGCCTTGGGGGGCTCCTAGCAACGGGCCTGGGCGGGAGTTCCATGGAGACTGGGGAGCGGACCCGTTTTATCTTCATCCTTGTCCTCCAGCTTCTTCTCCGCGTCCGACGCAACCAGCAGCAGCGCTGCCGCCGTGTCCTTTACGACCGCCCCGTCTTCCCACGGATGTGATCTTCGTGGTGGGAACCAAGTTTCTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTTTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGCCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGATGTTGGGAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCCCGTAGTCTGCAGAAACTAGGTTTTCAGGTCATCTTCACAGATTTTAAGGTGGTGAATGTTTTGGCAGTGTGTAACATGCCCTTTGAGATCCGTTTGCCAGAATTTACAAAGAACAATAGACCTCATGCCAGCTATGAACCTGAACTTCATCCTGCCGTGTGCTATCGGATAAAGTCTCTAAGAGCTACATTACAGATATTTTCAACAGGAAGCATCACAGTGACAGGGCCCAATGTAAAGGCTGTGGCGACTGCCGTGGAACAGATCTACCCGTTCGTGTTTGAAAGCAGGAAGGAGATTTTATAACTCAAACTTGGTTGGTTAGTCTCCACCTGAGCACCGTTTGAGACCTGCTGCACATTGGACTCAAAACACAAGGAAAACTGGACCAACAGTGACCGAGGACAGACTCGGACTCACAGCTGCAGTGTAAGCTCCAGTCCCTTTGGATTTTACTTCAAAGTTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACATTGCTGCTTTTACAAAAGGACGTTCTATTTATTTTCGCAGTAATCTCCATGTCCCACAGGCAGAGCTGTCGCAGTGTGCACTTCCCGACAGTTGTTTTATTGATGTCATTATTTTTCCAGTTGGAGCTAATGTGTTTGATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAACGTTATCTTTTTAAATTGAATGTGCACAAATAAAAGTTTGGAAAAGATCTCTCTTCATATCCATTCTGTAACTTTTATTCACCATTTTTTTCTTTTAAACAACTGTATTCATAATTTTTTTTAAATCTATGCAGGCTTAGACTTTGGCTAAAGTGTG