Transcript asmbl_35441

Sequence
Transcript Sequence for observation asmbl_35441 of TGE0002736:
GTGCTTTATAAGCGCCCGGCGCCGTCCGGCCCCTCCTTTCTGAGCCCCGGCGGTGCGCGCTACGGAGCTCGGCCAGCCTGCTCCGTCCTGACTCACCGCTGTTCGCTCCTGCTGAGGAACAAGTCGGTCAGGAAGCCGCGCCTCAGCCATGGCATTTAAAGATACCGGAAAGACGCCCGTGGAGCCCGAAGTGGCGATTCACCGAATTCGAATCACGCTCACCAGCCGCAACGTGAAGTCGCTGGAGAAGGTTTGTGCGGACTTGATCAGAGGCGCCAAGGAAAAGAATCTGAAAGTGAAAGGACCGGTGCGCATGCCTACCAAGACTTTGAGAATCACTACCAGAAAAACACCTTGTGGTGAAGGTTCCAAGACCTGGGATCGATTCCAGATGAGGATCCACAAGCGACTCATTGATTTACATAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCGGGAGTTGAGGTTGAAGTCACCATTGCAGATGCCTAAGACAACTGAATAAATCGTCTTAATGGTCAAA