Transcript asmbl_3489

Sequence
Transcript Sequence for observation asmbl_3489 of TGE0003685:
AGGGAAGTGAGTCGGACCGGGCTGGGCTCGCTAAAGGAGAGGCACCGCGGAGGGGCAGGCCAGCGTCGCGTCGCGATCCGGGATGTCGAAGAACACGGTGTCGTCGGCCCGCTTCCGGAAGGTGGACGTGGACGAATATGACGAGAACAAGTTCGTGGACGAGGAGGACGGCGGCGATGGCCAGGCCGGGCCCGACGAGGGCGAGGTGGACTCGTGCCTACGGCAAGGAAACATGACAGCTGCTCTCCAGGCTGCTCTGAAAAACCCCCCTATTAACACAAAGAGCCAGGCAGTGAAGGACCGTGCAGGCAGCATCGTCTTGAAGGTGCTTATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTGCAGTCTCTGGACAAGAACGGTGTGGACCTCCTAATGAAGTATATTTATAAAGGCTTTGAGAGCCCATCTGACAACAGCAGTGCTGTGTTGCTCCAGTGGCATGAAAAGGCCCTTGCTGCTGGAGGAGTGGGGTCCATTGTTCGAGTTTTGACTGCAAGGAAAACCGTGTAGTCCAGCTGGAACTGGACACCGTTCACAGAAGTGGGAGTTGCTGGTATAAAGACCAAAACAACCAAATGGCACCGCTGCCCTGTGGGTAGCATCTGTTTCTCTCAGCTTTGCCTTCTTGCTTCCTTTTTCATATCTGTAAAGAAGAAAATTACATATCAGTTTCCTTTAATGAAAATTGAAATAATGTGGAGAAAATTTTGTCTCAGTGGGGATGTTTGACCCTTTCATAACCATGTCAATAATATGTATCACATTCTGTAATTTATATTCAAGTTTGATTGTGCAATTTCTAACTCTGTTGCCTGGTTTAAGGGTTTTACTTTATTTTTAACCAATACTGAGAGATGTGATCAAAGTTGAGGCCAGTTTCCTAACTCATTGCTGGTCAGGAAGTGATCTTTATTTTTAAAAATGAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCACACTTCCCTTATTTAAGCAAAATGTGTTTCCAGGGCAAGTAGTGGGTGAGCCCTACTACCAGTTTCCAGCCTTCTTTCCGCTTGCCTCCAGATGATGCTATAAGTGTAAGTGTGCTACTTCCTGTTAGCATCCAACTTTCATGGCCTCTCAATCTCTTTGTGGTGACCCAGGGTCCGGAGCAAGGAGTCTTGCTCTATATAAATGTATTTACACAATATAAGCGCCTCTTTGGCACAAACATCCCATTTCCTTCTGGTAATAAGGCTGCCTGGGGAAACAGTCCCAAGTCAGAGACAGGCCTCCAGCAGCCTCTGGATGAAATACTTTCATCAGAAATAAGGTAGCTGCCTTAGCCATTACACAAGTGTTCACTGGAACATTTCCCATGATTTCCCGAGGACGTCTTCAGTGTTCTTCAGGTAATGGGGATCTCAGAAGATTTGGTTCTGATCCAAAGACACAGTCTGTGTTTCAGCTCAGTGTTTTTAAGAAAGAAAAATGCCACATAGTAAAAGAAAAAAAGTGTTTACTTCGTTGGACAAACCAAATTGATTCTCAAAAAATGACCGGTGCTTGTAAAAAGTTATTACAAAGTAGTTCCGAAACCAACCACCTGAATGTGCGTGGCCGAGAGGGAATCAGCCTGCTTGTCTTTCCCTAAGATGCCAACTCCAGAGTCACTGACTGAGGTGAGAACCAGCGCAGAAACTCTATAAACTGCTGTTTTTGATACCTGCTCTTTTTGTTTTGTTCTGTTTTGTAAAATTATGATAAACTTCAGAAAATAAAATGTCAGTGTTGAATAATTTT