Transcript asmbl_73545

Sequence
Transcript Sequence for observation asmbl_73545 of TGE0007602:
AAAAACGGGTGGCGGGGCCCCGCTGTCTTTTCAGTCGGGCGCTGAGTGGTTTTTCGGAACATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGACGATATGAACTTAAAGGAGTCTCTACTACGGGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCTATTCAGCAGAGAGCTATTATTCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTACATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGATATCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGATTTAAGGATCAAATCTACGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTTGTGTTGCTTTCTGCCACTATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAAAGAGAGGAATGGAAATTGGATACGCTTTGTGACTTGTATGAGACCCTCACCATTACACAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGAGACTTCACAGTTTCCGCTTTGCATGGTGATATGGACCAGAAGGAAAGAGATGTTATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCTCGTGGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAACACTACAGTGGAGGAAATGCCTATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGATAGTTTTGAATGCAGTGCCCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATTTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTTATTTCCTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCTTACCTGCCTTTATTGTGTTTGTCATTAGCCTGGAATAGAAAGGCCTTTAAAACTGATTTTTTTTAGAGAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCATCCTAGGTAGGGTTAAAACCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAA