Transcript asmbl_73544

Sequence
Transcript Sequence for observation asmbl_73544 of TGE0007600:
AAAAACGGGTGGCGGGGCCCCGCTGTCTTTTCAGTCGGGCGCTGAGTGGTTTTTCGGAACATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGACGATATGAACTTAAAGGAGTCTCTACTACGGGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCTATTCAGCAGAGAGCTATTATTCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTACATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGATATCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGATTTAAGGATCAAATCTACGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTGAGCTTTTATTTTTCTTCTGTAGCTGGAGATTAGGTTTATGCAGGTACTGTTAGAATACAACTGAAGTGTTCTATTGTCGTTTCCTCTGTTTAAAGTAATTGATGCATAACTGCCTGTCTACTGCAATTCCTTAGCAAGACAGAGACTCTTGGTCTCAAACACGTAGAGTATTGTGATGGTTGTGCTAATTAACTGCTTGTGTGACATCATCATCATTGTCCTTTTAAGGTTGTGTTGCTTTCTGCCACTATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAAAGAGAGGAATGGAAATTGGATACGCTTTGTGACTTGTATGAGACCCTCACCATTACACAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGAGACTTCACAGTTTCCGCTTTGCATGGTGATATGGACCAGAAGGAAAGAGATGTTATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCTCGTGGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAACACTACAGTGGAGGAAATGCCTATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGATAGTTTTGAATGCAGTGCCCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATTTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTTATTTCCTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCTTACCTGCCTTTATTGTGTTTGTCATTAGCCTGGAATAGAAAGGCCTTTAAAACTGATTTTTTTTAGAGAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCATCCTAGGTAGGGTTAAAACCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAA