Transcript asmbl_33118

Sequence
Transcript Sequence for observation asmbl_33118 of TGE0001954:
GGCTGCAGGGTCCTTGGTGCTGTGGCGGTGTGGTTGATTAGGGTGCTGCTTTCAATCGTGTGGCCTTTGGGAACCCCGCGTAGCCACTGCCGCCTCCTTCTGTCCTCGCCATGTTCCTCACTCGGTCCGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGCATCCAGACCTCAGAGGGTGTATGTCTAGCTGTGGAGAAGAGAATTACCTCCCCACTAATGGAGCCTAGCAGCATTGAGAAGATTGTAGAGATCGATGCTCATATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAAACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTATAATGAGACAATGACAGTTGAGAGTGTGACCCAGGCTGTGTCCAATCTGGCTCTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCTATGTCTCGTCCCTTTGGAGTAGCATTGTTGTTTGGAGGAGTTGATGAGAAAGGACCCCAACTGTTTCACATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCTGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCATAAGTCTATGACTCTGAAGGAGGCCATCAAGTCCTCGCTCATCATCCTCAAGCAAGTCATGGAGGAGAAGCTGAATGCAACCAACATCGAGCTAGCCACGGTGCAGCCTGGTCAGAATTTCCACATGTTCACAAAGGAAGAACTGGAGGAGGTGATCAAGGACATTTAAGAAGGAGCCGTCCTCGAACTTCTGTGGGACACTTTCAGTTCTAATTGCCCTTAGACTTTATTTCCAGCTCTTATGTCATGGAAAATATCCAGTATATGTGTGTGTGTTTTTTTATGAAGTCTGTACATAACAGCAATTCTG