Transcript asmbl_27397

Sequence
Transcript Sequence for observation asmbl_27397 of TGE0032891:
TTCCTCTCTGTGCTCCTGCAACTTAAACCGAATTCCTGGAGGAGTCTTCCGGCTTGGGCCTCCGCTGTGGTGCGGTTGTTGGGCACAATGCTTCCGGCCTCTTGTGCCTCACTTGTGGACTGGAGACTCAGGCCTCACTCACTTCGGTTCCTCAATTAACAGCAGAACCATCAACAAATGTTTGTTGGATAAGGACAAATAAAGAGATTGGAAAGGAGCGAAGCCTTTTTGACTTGTTTCACTTGTTCCCGCCTACTCCATCTTCTTCCAGGTCAGGGGGTGTGCCTCAGAGAAAGAAGGAAACGAATTTTGCGGGCGGTCACACACTTGGAACGTTTAGTCGGGCCTTTGGATTTCCCTAGTGTCTGTAATCACGCCGGGATCTCTTCTAATGGAACTCATTTGGTCAATGGCCTCACTATCCTCACATCATTCCTTTTTTTAGTTTGCGGTACTTCTGGAAACTGAAAACTAGCACAGGAGAATAGATGGGACTAGTAAAAACAGCAAAACCCACATCCCTGCGAGCTTCTTGCTTACGAAATCGATGCTCTAATCATTTATTTTGATCCCATTCTACTGCTTCAGTTTCTCTTTCATTTAACAGTTCCAACAGTCATGGAGAAGCGCCTTCAGGAGGCTCAGGTATACAAGGAGGAAGGAAACCAGCGCTACCGGGAAGGAAAGTACCGAGATGCTGTGAGTAGGTACCATCGAGCTCTTCTTCAGCTGCGGGGTCTGGACCCAAGTCTGCCTTCCCCTCTTTCTAGTCTGGGACCTCAGGGCCCAGCTCTCACACCGGAGCAAGAAAACATACTGCACACCATCCAGACCCACTGCTACAACAACCTAGCTGCCTGTCTCCTCCAGATGGAGCCAGTGAACTATGAACGAGTGAGGGAATACAGTCAGAAAGTCCTAGAACGACAACCCGATAATGCCAAGGCCTTGTATCGGGCTGGAGTAGCCTTCTTCCACCTGCAAGACTATGACCGGGCTCGACACCACCTGCTTGCTGCTGTCAATAGGCAACCTAAAGATGCCAATGTTCGGCGGTACCTCCAGTTGACGCAGTCAGAACTCAGCAGCTACCATAGGAAGGAGAAACAGCTGTACCTGGGCATGTTTGGTTAATGAAGAAAAGAGACATTTCTCAACTTGAACTCAAGTGGACAAGCAAAGGCCCATTGGGGAATCTGAGCCTCACTCAGCAAAAGGAGTTCACCCTTTACCTCTGACCCAGGTGGATTTCCATTTTGTTTCCTGTTCTGCACAAGTTCTTTGCTCCTTAGACCATCTGCATCGTTTATTGTCTGTCCCCTAGTGTATTTGTATGGCTTACAATCTGAGAACATTCATCGACTGTGGGTGGAATCAACTGTATTTGTGGCATAGATTTAATGGGGTGTTATTAAATGTTCTCAGACACAGAGGAGAGGGCCGGTGAAGGGTGAGAGAGTAAGGACAGGCAAACAGGAATCTTCTGTAGTATCTTCAGATGCTTTTGTTTTGCTTAGTGGGATTTTTTTTTCTTTTAATTATAAATTGAGCCCAAGTATATTTACATTAAAGATTTGAAATTAGCTGGGTGTGGTGGCGCACACGTTTAGTCCCAGCACTTGGGGGAGTCAGGCAGATTTCTGAGTTTGAGGC