Transcript asmbl_27396

Sequence
Transcript Sequence for observation asmbl_27396 of TGE0032891:
TTCCTCTCTGTGCTCCTGCAACTTAAACCGAATTCCTGGAGGAGTCTTCCGGCTTGGGCCTCCGCTGTGGTGCGGTTGTTGGGCACAATGCTTCCGGCCTCTTGTGCCTCACTTGTGGACTGGAGACTCAGGCCTCACTCACTTCGGTTCCTCAATTAACAGCAGAACCATCAACAAATGTTTGTTGGATAAGGACAAATAAAGAGATTGGAAAGGAGCGAAGCCTTTTTGACTTGTTTCACTTGTTCCCGCCTACTCCATCTTCTTCCAGTTCCAACAGTCATGGAGAAGCGCCTTCAGGAGGCTCAGGTATACAAGGAGGAAGGAAACCAGCGCTACCGGGAAGGAAAGTACCGAGATGCTGTGAGTAGGTACCATCGAGCTCTTCTTCAGCTGCGGGGTCTGGACCCAAGTCTGCCTTCCCCTCTTTCTAGTCTGGGACCTCAGGGCCCAGCTCTCACACCGGAGCAAGAAAACATACTGCACACCATCCAGACCCACTGCTACAACAACCTAGCTGCCTGTCTCCTCCAGATGGAGCCAGTGAACTATGAACGAGTGAGGGAATACAGTCAGAAAGTCCTAGAACGACAACCCGATAATGCCAAGGCCTTGTATCGGGCTGGAGTAGCCTTCTTCCACCTGCAAGACTATGACCGGGCTCGACACCACCTGCTTGCTGCTGTCAATAGGCAACCTAAAGATGCCAATGTTCGGCGGTACCTCCAGTTGACGCAGTCAGAACTCAGCAGCTACCATAGGAAGGAGAAACAGCTGTACCTGGGCATGTTTGGTTAATGAAGAAAAGAGACATTTCTCAACTTGAACTCAAGTGGACAAGCAAAGGCCCATTGGGGAATCTGAGCCTCACTCAGCAAAAGGAGTTCACCCTTTACCTCTGACCCAGGTGGATTTCCATTTTGTTTCCTGTTCTGCACAAGTTCTTTGCTCCTTAGACCATCTGCATCGTTTATTGTCTGTCCCCTAGTGTATTTGTATGGCTTACAATCTGAGAACATTCATCGACTGTGGGTGGAATCAACTGTATTTGTGGCATAGATTTAATGGGGTGTTATTAAATGTTCTCAGACACAGAGGAGAGGGCCGGTGAAGGGTGAGAGAGTAAGGACAGGCAAACAGGAATCTTCTGTAGTATCTTCAGATGCTTTTGTTTTGCTTAGTGGGATTTTTTTTTCTTTTAATTATAAATTGAGCCCAAGTATATTTACATTAAAGATTTGAAATTAGCTGGGTGTGGTGGCGCACACGTTTAGTCCCAGCACTTGGGGGAGTCAGGCAGATTTCTGAGTTTGAGGC