Transcript asmbl_27395

Sequence
Transcript Sequence for observation asmbl_27395 of TGE0032891:
TTCCTCTCTGTGCTCCTGCAACTTAAACCGAATTCCTGGAGGAGTCTTCCGGCTTGGGCCTCCGCTGTGGTGCGGTTGTTGGGCACAATGCTTCCGGCCTCTTGTGCCTCACTTGTGGACTGGAGACTCAGGCCTCACTCACTTCGGTTCCTCAATTAACAGCAGAACCATCAACAAATGTTTGTTGGATAAGGACAAATAAAGAGATTGGAAAGGAGCGAAGCCTTTTTGACTTGTTTCACTTGTTCCCGCCTACTCCATCTTCTTCCAGTTCCAACAGTCATGGAGAAGCGCCTTCAGGAGGCTCAGGTATACAAGGAGGAAGGAAACCAGCGCTACCGGGAAGGAAAGTACCGAGATGCTGTGAGTAGGTACCATCGAGCTCTTCTTCAGCTGCGGGGTCTGGACCCAAGTCTGCCTTCCCCTCTTTCTAGTCTGGGACCTCAGGGCCCAGCTCTCACACCGGAGCAAGAAAACATACTGCACACCATCCAGACCCACTGCTACAACAACCTAGCTGCCTGTCTCCTCCAGATGGAGCCAGTGAACTATGAACGAGTGAGGGAATACAGTCAGAAAGTCCTAGAACGACAACCCGATAATGCCAAGGCCTTGTATCGGGCTGGAGTAGCCTTCTTCCACCTGCAAGACTATGACCGGGCTCGACACCACCTGCTTGCTGCTGTCAATAGGCAACCTAAAGATGCCAATGTTCGGCGGTACCTCCAGTTGACGCAGTCAGAACTCAGCAGCTACCATAGGAAGGAGAAACAGCTGTACCTGGGCATGTTTGGTTAATGAAGAAAAGAGACATTTCTCAACTTGAACTCAAGTGGACAAGCAAAGGCCCATTGGGGAATCTGAGCCTCACTCAGCAAAAGGAGTTCACCCTTTACCTCTGACCCAGGCAGACTTGGTGGTAGATGCCTGCAATCCCAGCACTTTGGAGTCTAAACCATGACAATCACAAATTCAAGGTCAGTCAGATCTTGTCTCAGAATTAAAGGGCTGGAGATAACAGCTCTGTGGGAAAACCCTGGGTTTAATTCCCCTTTCTGGTTTTTGGTTTGCTTTGTTCCCTCCTGGTAATTTCTAGTCCTTGCTATTGCTTGCACTCAGATCACTGACAAAGTACAACTTATTTGTCATTAATTTAGTCTTTTTTTAAAACTTCTGGAGTGAATGCCTGGGATACATGAAACCCTGTTTTTACCTTCTCTCTGACCTTGTGCCAAGAAGGAACCCA