Transcript asmbl_27351

Sequence
Transcript Sequence for observation asmbl_27351 of TGE0032880:
AAAAGGTTTAGCGAGGTAGGTCCGGGTCCCGGAGGCTCCACCCTGAACTATATGGGCGATGAACCCTTGTGCAGTTACCTGCAGGCGCAGCGGGAAGCCACGCGTGCCCACGCCCCGCACATGGGAGCTTAGGAGATTGTGGGTGAGCAGTTTCATGTTGTCACAGCGGAGCGCGTGAGGCCGGAACCGGAAGGAGTCCACACTTCTCCTTTCTACCACTTCCGCTTTGAAGCCGTTGAACTCTTCGCCGGACCGGAAGTGGCCGACTTAGGGGACCTTTTGGGGGGCTTGGCGGCAGCCGAGATCGGAAGGACTGTGTTGGGTCACGTCCTGGTACCGGAAGCGTTTCTCGGGGAGACTGCAAAGGCTTACGCCGAATCCCGCTCGCTGAAGAGAGTACACACTATGCAAGTCACGTGTAAACCGGCTGCGTTACGGCGCAGGTAAAACGAACACATTTGAGGCTCAGCCAGATCATCCCCGACCTCTGTTTGCGGCTATGGGTCACGAACTGTCACGTCGGTAAACCAGGCACCTCTTTCTGCGATTGAAGAAGGTGTGCGAGCCCTGAGAGCCCCGCCGCGTCGTAGTGCGTCACGGCCCTGCCCCTCTAAGCCGGCGCTGTGGCTGCGACGTGGGACGTGCGGCGTGGGCGGAGCTGTCCCTGCATCCACCTCCTGTGGGCAGAGCCATCTGCGGGTGGGCTGCGGCAGCGGGGCGGGTATGCTACAGCTGGGGCTTCGAGTCCTGGGCTGCAAAGCCAGTTCTGTGCTCCGTGCATCGACGTGCTTGGCAGGCAGAGCAGGCCGGAAAGAAGCAGGTTGGGAGTGTGGCGGAGCCCGCAGCTTCAGCAGCTCCGCGGTGACCATGGCCCCGATCAAGGTGGGAGATGCCATTCCCTCAGTGGAGGTATTTGAAGGGGAACCGGGAAAGAAGGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAAGGTGTTTTGTTTGGAGTCCCTGGGGCATTTACACCTGGCTGTTCTAAGACCCACCTGCCTGGGTTTGTGGAGCAAGCTGGAGCTCTGAAGGCCAAGGGAGCGCAGGTGGTGGCCTGTCTGAGCGTTAATGACGTCTTTGTGATTGAAGAGTGGGGTCGAGCCCACCAGGCAGAAGGCAAGGTTCGGCTCCTGGCTGACCCCACTGGAGCCTTTGGGAAGGCGACAGACTTATTATTGGATGATTCTTTGGTGTCTCTCTTTGGGAATCGTCGGCTGAAAAGGTTCTCCATGGTGATAGACAACGGCATAGTGAAGGCACTGAACGTGGAGCCAGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCTCAACTCTGAGGCCCTGGCCAGATGTCCTCTGACTCTCCCATCTCTCCCACCCGGCTCTAGGCCAAAAGGCTCGGTACCTCCTTACTGGGAGCCACGTAAATGGAACCTTGACCATATTTCTGCAATAAACAGTTTAATTTGTGTCTTTA