Transcript asmbl_27340

Sequence
Transcript Sequence for observation asmbl_27340 of TGE0032877:
GGGAGCGGGGTCCCGGGACTAGAAGAAACGGCGGCCGGGAGGGGGCTACGGGATCATGGGGCTTCTGACCATTCTGAAGAAGATGAAGCAGAAAGAGCGAGAGCTGCGGCTGCTCATGCTTGGCTTGGACAACGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAAGACGTGGACACCATCTCCCCGACACTGGGCTTCAACATCAAGACCCTGGAGCACCGCGGATTCAAGCTGAACATCTGGGATGTAGGTGGCCAGAAGTCTCTGCGCTCCTACTGGAGGAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCCGACCGCCAGCGCATGCAGGACTGTCAGCGAGAGCTGCAGAGCCTACTGGTGGAGGAGCGCCTGGCTGGAGCAACCCTCCTCATCTTTGCCAACAAGCAGGACCTGCCTGGAGCACTGTCCTGTAATGCTATTCAGGAGGCCCTGGAGCTGGACTCCATCCGCAGCCACCACTGGCGCATCCAGGGCTGCAGTGCTGTCACAGGGGAAGACCTGCTGCCTGGCATCGACTGGCTCCTTGATGACATTTCCAGTCGTGTCTTTACTGCCGACTGAGCTTCTTCAGTGTCCCCAGGTCCCTGTCCTCATCAGACACCAGCCAGAGGGATGAGCACCAGCTGGCCAGACTAACACTCCCAACCCCACCATGACCTGCTGCTGCTATTACTGCCCATTGCTGCTCCCCCGGGTGAGGGCTGTCACCCTGTCTCCCAAAGTGGCCTGCAGCTGCCATGCCAAAAGGAAAGGCTGGGCTGGGAGGGACTACCTGCTGCTGCCAGGGTCCTAGGTGTCGCCTCGCCTCGGTCCAGCAGTGAGAATAAAGCACTCTTCACCCAG