Transcript asmbl_25441

Sequence
Transcript Sequence for observation asmbl_25441 of TGE0002143:
GGAGGAAGTGAGATCAGAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAGCCGGTGTCCTACGTCAGAGCCGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCGCTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACGAGCATGATATCGCTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGACGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTCGGAGCCATCACATCTGTACAACAGAGACTCAAACTTTATAACAAAGTACCTCCAAATGGTCTGGTTGTTTACTGTGGAACAATTGTAACAGAAGAAGGAAAGGAAAAGAAAGTTAACATTGACTTTGAACCTTTCAAACCAATTAATACATCATTGTATTTGTGCGACAATAAGTTTCATACAGAGGCTCTTACAGCGTTACTTTCAGATGACAGCAAGTTTGGTTTTATTGTAATAGACGGAAGTGGTGCTCTTTTTGGCACGCTCCAAGGAAACACCAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACACGGCAGAGGAGGTCAATCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGAGACATAACTATGTTCGGAAAGTAGCCGAGACTGCTGTGCAGCTGTTTATTTCTGGAGACAAAGTGAATGTGGCTGGTTTGGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGACATGTTTGACCAGAGGTTGCAATCTAAAGTTTTAAAATTAGTTGATATATCCTATGGTGGTGAAAATGGATTCAACCAAGCTATTGAATTATCTACTGAAGTTCTCTCCAACGTGAAGTTCATTCAAGAGAAGAAATTAATAGGACGATATTTTGATGAAATTAGCCAGGACACAGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTGGAAATGGGAGCTGTAGAAATTCTAATAGTCTATGAAAATCTGGATATAATGAGATACGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATTTAACTCCAGAACAAGAGAAGGATAAATCTCACTTCACAGACAAAGAGACTGGACAGGAACACGAACTGATAGAAAGCATGCCTCTCTTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACACTAGAAATTGTCACAGATAAGTCACAAGAAGGATCACAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAGTACCAAGGAGGAGATGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAACCGTGCCTCACCCTCCAGCATTCAACCCAAGGAGCATACCCGTGGTGGAGTCCAACAGATCCCTGCCTTACAATTGGAGCATTTCCAGAACTTAATCCGTGAGCATTGGATACTGAAAAGAAAAGTGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCGTGGTGTCAGCGCAGCAGCCGACAACTAAGTCTCTAAAGGCCACTGTGGACTCATTTAAAAAGAATCCCAGTTTTTACTTTTACTTGATGGTAAAATTGGTTGCTCTTGTATTTTATGAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAGTAGACGTGAGGTCATACTGGTTTGTTTCTTCCTTTGATCGGAGAATAACTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCGGCTTAGACTGCACAAGAAGAAATATATGTGAAATATTGGAACTGTTTCTCTCTTGGTCTCTGTTTAATGTTGAAAGGGTGAGCTGACAGGAGGCAGTTTGAGCTTCACTCCCTCACACTCCCCACTCCCAGACTGTCCCTTTCAAAGGTGCAGGTTGCGTTGTAAAGTCAGACTGAGTGCCAACACACTGGGGCCAGGGCACTCTGGGCAGTCACCAGTGTGGAGGCACAGTTGTGCCTGGCATTTGGGAGCCCTCTGTGCCATTAGCGTTACTGAGGCTCCCTGTCATCTCAGCCTACTAGAAACCAGTCTGGGATGGACATGATGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAACTTAAGTGGAACCAAAAAAAAATTCAAAGATGATTTTGCTTGGATCTATTCTTGGTAAGGGGAGGCGGTGGTGTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTATTTTTTTGTTTTCAAATGAACTGCAAGATTTTTTTCACGGGAACGACAGACACGACACGTATGACCGTGCATGTATCTCAAACCCCTGGTGGGGCTGGAGCATCTATTTCAAAAAGTGGGATCTACAAGCACCTCTCAGATGAGAAAG